Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30696
Trapped Gene
Gm1060 (ENSMUSG00000073102)
Vector Insertion
Chr 5: 30608133 - 30643988
Public Clones IST10190F1 (tigm) IST12765A2 (tigm) IST10930C2 (tigm) IST10262A6 (tigm)
IST14462A6 (tigm) IST10779D6 (tigm) IST14745E3 (tigm) IST11476H3HMF2 (tigm)
IST11439H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655076 (Chr5:30607914..30608132 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTAGCCACCCCGATTCTC Chr5:30608027..30608046 60.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655076 (Chr5:30607914..30608132 +)
Downstram Exon
ENSMUSE00000700533 (Chr5:30643989..30644076 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTAGCCACCCCGATTCTC Chr5:30608027..30608046 60.46 55 CTTGCTCTGCTCCTCCTCAC Chr5:30644049..30644068 60.28 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655076 Chr5:30607914..30608132 ACTTAGCCACCCCGATTCTC Chr5:30608027..30608046 60.46 55

*** Putative Vector Insertion (Chr 5: 30608133 - 30643988) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700533 Chr5:30643989..30644076 CTTGCTCTGCTCCTCCTCAC Chr5:30644049..30644068 60.28 60
downstream ENSMUSE00000700532 Chr5:30644860..30644972 TCAACCCTCCTGTGGATCTC Chr5:30644951..30644970 60.05 55
downstream ENSMUSE00000700530 Chr5:30647773..30647956 GTTGGCCAGCTTGTTCTTGT Chr5:30647947..30647966 60.3 50
downstream ENSMUSE00000700528 Chr5:30649338..30649475 GGGTGATGTCTTCCGACTGT Chr5:30649404..30649423 59.97 55
downstream ENSMUSE00000700526 Chr5:30650945..30651031 TTCTTGCCGTTCTGACTCAA Chr5:30650974..30650993 59.57 45
downstream ENSMUSE00000700525 Chr5:30652683..30652805 CATGCGGTTGGTGAGGTACT Chr5:30652709..30652728 60.97 55
downstream ENSMUSE00000700524 Chr5:30657421..30657560 CATCTGCTGAAGCTGTTGCT Chr5:30657450..30657469 59.34 50
downstream ENSMUSE00000700523 Chr5:30657894..30658028 TCACAAGCCGTTTGTAGTCG Chr5:30658000..30658019 59.9 50
downstream ENSMUSE00000700521 Chr5:30658548..30658780 TCTCCCGAAACTTCTCCTCA Chr5:30658588..30658607 59.92 50
downstream ENSMUSE00000700520 Chr5:30660746..30660858 GTGGTGGTTTTGGCTGAAAT Chr5:30660830..30660849 59.84 45
downstream ENSMUSE00000700519 Chr5:30661851..30661940 GGGGTGGAGCAGACTCAGTA Chr5:30661895..30661914 60.26 60
downstream ENSMUSE00000700518 Chr5:30662284..30662370 GCTCGGTATCGAAGGAAGAA Chr5:30662351..30662370 59.41 50
downstream ENSMUSE00000700517 Chr5:30665286..30665557 AGGCTTGTACGCTCCACATT Chr5:30665329..30665348 59.76 50
downstream ENSMUSE00000700516 Chr5:30666238..30666381 TCCCAGTACTCCGTGTCCTT Chr5:30666309..30666328 59.57 55
downstream ENSMUSE00000700515 Chr5:30666671..30666773 CATTCTCCATCAGCAGCTTG Chr5:30666714..30666733 59.55 50
downstream ENSMUSE00000700512 Chr5:30668777..30668993 GGTGGGATCTGCAGTTCTGT Chr5:30668805..30668824 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTCCTTCCACACATTGCT Chr5:30608110..30608130 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTCCTTCCACACATTGCT Chr5:30608110..30608130 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073102