Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30698
Trapped Gene
Lrriq4 (ENSMUSG00000027703)
Vector Insertion
Chr 3: 30545236 - 30547147
Public Clones (sanger) IST11440F5HMF1 (tigm) IST10656F12 (tigm) IST12627C3 (tigm)
IST10656F12 (tigm) IST10902H12 (tigm) IST14437B8 (tigm) IST14338H2 (tigm)
IST13129B5 (tigm) IST12401H2 (tigm) IST12401H2 (tigm) IST14384G1 (tigm)
IST12241F7 (tigm) IST14384G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000172454 (Chr3:30545175..30545235 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTCTTCAGAATGGCCTTG Chr3:30545185..30545204 58.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000172454 (Chr3:30545175..30545235 +)
Downstram Exon
ENSMUSE00000676162 (Chr3:30547148..30547182 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTCTTCAGAATGGCCTTG Chr3:30545185..30545204 58.85 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676165 Chr3:30543429..30543774 CAAGAGCAACAACCAGGACA Chr3:30543716..30543735 59.87 50
upstream ENSMUSE00000639711 Chr3:30544140..30544270 CTGGAGCTTCTCCATCGACT Chr3:30544212..30544231 59.56 55
upstream ENSMUSE00000172454 Chr3:30545175..30545235 TGTTCTTCAGAATGGCCTTG Chr3:30545185..30545204 58.85 45

*** Putative Vector Insertion (Chr 3: 30545236 - 30547147) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676162 Chr3:30547148..30547182 No primer for this exon
downstream ENSMUSE00000274098 Chr3:30548827..30549874 ATCTGCACGGGAAAGTGTTC Chr3:30549822..30549841 60.12 50
downstream ENSMUSE00000172455 Chr3:30554559..30554732 ATTTCCTGTGAGCCCGAGTA Chr3:30554618..30554637 59.69 50
downstream ENSMUSE00000172449 Chr3:30557976..30558114 GCTGTTCCAGTCGGTTGTTC Chr3:30558021..30558040 60.7 55
downstream ENSMUSE00000172451 Chr3:30558823..30559019 CATGGGGTTGTTCATCAGTG Chr3:30558929..30558948 59.81 50
downstream ENSMUSE00000676164 Chr3:30571063..30571353 GTCCTTTGGAGGGGATTTTC Chr3:30571164..30571183 59.74 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTTAATCGCCTTGCAGCAC Chr3:30545283..30545304 61.65 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATATTACTTCGTGACTGGGAAA Chr3:30545276..30545300 59.45 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027703