Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30703
Trapped Gene
Antxr2 (ENSMUSG00000029338)
Vector Insertion
Chr 5: 98433877 - 98456562
Public Clones IST11248F8HMF2 (tigm) IST11991C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000477406 (Chr5:98456490..98456561 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCTTCCCAAGCAACCATT Chr5:98456513..98456532 59.55 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000477406 (Chr5:98456490..98456561 -)
Downstram Exon
ENSMUSE00000330151 (Chr5:98433878..98433959 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCTTCCCAAGCAACCATT Chr5:98456513..98456532 59.55 40 ACGGCCTTTAAATCCTCCAG Chr5:98433899..98433918 60.44 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651876 Chr5:98459417..98459752 GCCTCTTTCACGTCTCTGCT Chr5:98459645..98459664 59.75 55
upstream ENSMUSE00000478183 Chr5:98458603..98458674 TTGTCCACCAGCTGACAGAG Chr5:98458614..98458633 60.02 55
upstream ENSMUSE00000477406 Chr5:98456490..98456561 TTTCTTCCCAAGCAACCATT Chr5:98456513..98456532 59.55 40
upstream ENSMUSE00000330151 Chr5:98433878..98433959 CCGTTAAGCCAGTTGGAGAA Chr5:98433905..98433924 60.24 50

*** Putative Vector Insertion (Chr 5: 98433877 - 98456562) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000330146 Chr5:98433284..98433391 CCGTCCGTCAAAGCAATTAT Chr5:98433302..98433321 59.96 45
downstream ENSMUSE00000330143 Chr5:98433075..98433143 ACACTAGCGCCAAGTGACCT Chr5:98433090..98433109 59.94 55
downstream ENSMUSE00000330135 Chr5:98432246..98432326 TTGACAGGGAAAACCTGGTC Chr5:98432261..98432280 59.94 50
downstream ENSMUSE00000330129 Chr5:98408993..98409053 TTGAAGGACTCAATTCCAGGAT Chr5:98408986..98409007 59.94 40.91
downstream ENSMUSE00000330123 Chr5:98406620..98406718 CGTGACTGATCGACGTGACT Chr5:98406646..98406665 59.9 55
downstream ENSMUSE00000363178 Chr5:98404340..98404409 AAGGATGGAACTTGGCTGAA Chr5:98404350..98404369 59.67 45
downstream ENSMUSE00000330207 Chr5:98394701..98394779 GAGACAGCAGACTTCCCATCA Chr5:98394710..98394730 60.4 52.38
downstream ENSMUSE00000330200 Chr5:98389629..98389724 AAGAGCAGCAACAACACCAA Chr5:98389653..98389672 59.49 45
downstream ENSMUSE00000188068 Chr5:98378189..98378230 No primer for this exon
downstream ENSMUSE00000188065 Chr5:98377264..98377359 ACAGTCGGCCACTTCTTGTT Chr5:98377294..98377313 59.77 50
downstream ENSMUSE00000188066 Chr5:98367422..98367586 ATGGGATGGGGATCTCTTCT Chr5:98367465..98367484 59.71 50
downstream ENSMUSE00000188067 Chr5:98367106..98367186 GACACCCGGTCATACTGCTT Chr5:98367112..98367131 60 55
downstream ENSMUSE00000693770 Chr5:98311802..98315619 TACCTTGAGGCGTCTCGTCT Chr5:98314906..98314925 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCTTCCCAAGCAACCATT Chr5:98453511..98453531 59.55 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCCAGCAAACTGGGGTAG Chr5:98435567..98435587 61.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029338