Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30725
Trapped Gene
Pnp1 (ENSMUSG00000021871)
Vector Insertion
Chr 14: 51564269 - 51567257
Public Clones IST10013G2BBR1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289946 (Chr14:51564212..51564268 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289946 (Chr14:51564212..51564268 +)
Downstram Exon
ENSMUSE00000688658 (Chr14:51567258..51567265 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289946 Chr14:51564212..51564268 No primer for this exon

*** Putative Vector Insertion (Chr 14: 51564269 - 51567257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688658 Chr14:51567258..51567265 No primer for this exon
downstream ENSMUSE00000560158 Chr14:51567527..51567696 GTGAGCAGTCAGCCCTCCTA Chr14:51567641..51567660 60.56 60
downstream ENSMUSE00000617136 Chr14:51569933..51570036 TACATATGGAACCGGCCTTG Chr14:51570017..51570036 60.71 50
downstream ENSMUSE00000617135 Chr14:51570218..51570393 TCAAAATTGGGGTTGAGTCC Chr14:51570309..51570328 59.77 45
downstream ENSMUSE00000617134 Chr14:51570507..51570697 ATCCCGGTCATAAGCATCAG Chr14:51570555..51570574 59.92 50
downstream ENSMUSE00000496127 Chr14:51571079..51571688 AGTGCCTTGCGACGATAACT Chr14:51571120..51571139 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:51567258..51567278 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCCAAAGGACGTGACTG Chr14:51567247..51567267 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021871