Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30733
Trapped Gene
Zdhhc19 (ENSMUSG00000052363)
Vector Insertion
Chr 16: 32499813 - 32506032
Public Clones IST14936D7 (tigm) IST14588D4 (tigm) IST14167F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000619847 (Chr16:32499707..32499812 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTGATTCCGCTCTTCCTG Chr16:32499736..32499755 60.32 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000619847 (Chr16:32499707..32499812 +)
Downstram Exon
ENSMUSE00000619846 (Chr16:32506033..32506118 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTGATTCCGCTCTTCCTG Chr16:32499736..32499755 60.32 45 AGGGTTGTATTCCGGATGGT Chr16:32506062..32506081 60.44 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000619848 Chr16:32496351..32496409 GGGTCATTAAGGGAAAGACCA Chr16:32496362..32496382 60.17 47.62
upstream ENSMUSE00000455711 Chr16:32497075..32497318 TTGCTGCCTTCAATGTAACG Chr16:32497261..32497280 59.87 45
upstream ENSMUSE00000455696 Chr16:32497661..32497782 TCGTCTCGCTCAACTTCTCA Chr16:32497741..32497760 59.85 50
upstream ENSMUSE00000455691 Chr16:32498398..32498537 GCATGTTGTTCGAGTGAACC Chr16:32498426..32498445 59.14 50
upstream ENSMUSE00000455689 Chr16:32499061..32499233 TATTTCGCACAAGGCATCTG Chr16:32499188..32499207 59.83 45
upstream ENSMUSE00000619847 Chr16:32499707..32499812 TTTTGATTCCGCTCTTCCTG Chr16:32499736..32499755 60.32 45

*** Putative Vector Insertion (Chr 16: 32499813 - 32506032) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000619846 Chr16:32506033..32506118 AGGGTTGTATTCCGGATGGT Chr16:32506062..32506081 60.44 50
downstream ENSMUSE00000619845 Chr16:32506437..32506663 CTCTTGGATCCATGCTGTCC Chr16:32506497..32506516 60.62 55
downstream ENSMUSE00000619844 Chr16:32507132..32507299 AGGATGGGTAGGTCCCAAGT Chr16:32507276..32507295 59.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCCAGGCCCTATCTGTGA Chr16:32499765..32499785 60.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGGGAAGCATCCGTGACT Chr16:32499851..32499871 60.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052363