Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30734
Trapped Gene
Shroom4 (ENSMUSG00000068270)
Vector Insertion
Chr X: 6098063 - 6154403
Public Clones (sanger) (sanger) (sanger) IST13773F2 (tigm) IST12044E6 (tigm)
IST14515F8 (tigm) IST14884C10 (tigm) IST13806B4 (tigm) IST12393E7 (tigm)
IST12466G8 (tigm) IST12266C7 (tigm) IST13423D3 (tigm) IST13423D3 (tigm)
IST10719F6 (tigm) IST14897B5 (tigm) IST12641D2 (tigm) IST13273G7 (tigm)
IST13626C10 (tigm) IST11419E6 (tigm) IST13626C10 (tigm) IST12541G9 (tigm)
IST12973B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660997 (ChrX:6097911..6098062 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGGTGATGAGCTGGTGA ChrX:6097952..6097971 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660997 (ChrX:6097911..6098062 +)
Downstram Exon
ENSMUSE00000558640 (ChrX:6154404..6154714 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGGTGATGAGCTGGTGA ChrX:6097952..6097971 59.83 55 TCTCACCATCAACCACTCCA ChrX:6154654..6154673 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000625056 ChrX:5977263..5977379 No primer for this exon
upstream ENSMUSE00000660997 ChrX:6097911..6098062 GACTGGTGATGAGCTGGTGA ChrX:6097952..6097971 59.83 55

*** Putative Vector Insertion (Chr X: 6098063 - 6154403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000558640 ChrX:6154404..6154714 TCTCACCATCAACCACTCCA ChrX:6154654..6154673 60.09 50
downstream ENSMUSE00000558639 ChrX:6157947..6158081 AATGCCAGGACAAGCTGAAG ChrX:6158068..6158087 60.4 50
downstream ENSMUSE00000704055 ChrX:6157947..6158081 AATGCCAGGACAAGCTGAAG ChrX:6158068..6158087 60.4 50
downstream ENSMUSE00000558638 ChrX:6160310..6162773 CTCTACGCCTCCCCTAGCTT ChrX:6161933..6161952 60 60
downstream ENSMUSE00000558637 ChrX:6168074..6168135 TTCCACTTGTCCACAGGAAA ChrX:6168099..6168118 59.11 45
downstream ENSMUSE00000558636 ChrX:6200778..6201554 CCCTTACTGGAGGCACAAAA ChrX:6201457..6201476 60.1 50
downstream ENSMUSE00000558635 ChrX:6206219..6206399 GCCTTGGCCACAGAGATATT ChrX:6206311..6206330 59.15 50
downstream ENSMUSE00000558634 ChrX:6209341..6209610 ACCACTTTGTCCAGGTCTCC ChrX:6209528..6209547 59 55
downstream ENSMUSE00000558633 ChrX:6210566..6214566 TAGTGCTTTGCGCATCAATC ChrX:6212444..6212463 59.98 45
downstream ENSMUSE00000660996 ChrX:6210566..6210835 AATCTTGGAGCTGGTCCTGA ChrX:6210707..6210726 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACAAGAAATCGCAACATTT ChrX:6137073..6137094 59.99 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGATCGTGACTGGGAAAA ChrX:6137108..6137128 61.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068270