Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3074
Trapped Gene
Ndufa13 (ENSMUSG00000036199)
Vector Insertion
Chr 8: 72419220 - 72425440
Public Clones DC0251 (sanger) (ggtc) CMHD-GT_268D1-3 (cmhd) CMHD-GT_268G2-3 (cmhd) CMHD-GT_268D2-3 (cmhd)
Private Clones OST460942 (lexicon) OST460491 (lexicon) OST453543 (lexicon) OST406132 (lexicon)
OST396472 (lexicon) OST384373 (lexicon) OST366641 (lexicon) OST277060 (lexicon)
OST259974 (lexicon) OST214337 (lexicon) OST184645 (lexicon) OST169236 (lexicon)
OST89727 (lexicon) OST79342 (lexicon) OST48508 (lexicon) OST37550 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683012 (Chr8:72425441..72425547 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCGACTACAAGCGGAACC Chr8:72425462..72425481 60.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683012 (Chr8:72425441..72425547 -)
Downstram Exon
ENSMUSE00000235929 (Chr8:72419141..72419219 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCGACTACAAGCGGAACC Chr8:72425462..72425481 60.66 55 CCTGGTTCCACCTCATCATT Chr8:72419126..72419145 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683012 Chr8:72425441..72425547 CATCGACTACAAGCGGAACC Chr8:72425462..72425481 60.66 55

*** Putative Vector Insertion (Chr 8: 72419220 - 72425440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235929 Chr8:72419141..72419219 CCTGGTTCCACCTCATCATT Chr8:72419126..72419145 59.78 50
downstream ENSMUSE00000235919 Chr8:72418403..72418474 CCTCCAAGTCCTCAATCAGC Chr8:72418427..72418446 59.8 55
downstream ENSMUSE00000401758 Chr8:72418087..72418309 CTTCCTCCTCCAGGTTTTCC Chr8:72418250..72418269 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCCAGACTGCCTAGTA Chr8:72419395..72419415 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTATGCGTGACTGGGAAA Chr8:72425376..72425396 60.11 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr8:72419478..72419498 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGTCGAAGGTGAAGCAGGAC Chr8:72422506..72422526 63.27 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036199