Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30740
Trapped Gene
Akap9 (ENSMUSG00000040407)
Vector Insertion
Chr 5: 3928491 - 3948680
Public Clones (sanger) IST11066B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000555151 (Chr5:3928186..3928490 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTCTGTCCGCCTCTTTCT Chr5:3928375..3928394 60.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000555151 (Chr5:3928186..3928490 +)
Downstram Exon
ENSMUSE00000656238 (Chr5:3948681..3948896 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTCTGTCCGCCTCTTTCT Chr5:3928375..3928394 60.67 55 ATCAGGATTCCCGGCTAAGT Chr5:3948854..3948873 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000555151 Chr5:3928186..3928490 AGCTCTGTCCGCCTCTTTCT Chr5:3928375..3928394 60.67 55

*** Putative Vector Insertion (Chr 5: 3928491 - 3948680) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656238 Chr5:3948681..3948896 ATCAGGATTCCCGGCTAAGT Chr5:3948854..3948873 59.92 50
downstream ENSMUSE00000656236 Chr5:3951690..3951734 CTCCGAGCTACATTCATCTGC Chr5:3951736..3951756 59.99 52.38
downstream ENSMUSE00000555130 Chr5:3954397..3954450 GGCTTTCTTGGTTTCATCACA Chr5:3954436..3954456 60.1 42.86
downstream ENSMUSE00000656233 Chr5:3954792..3954962 CTCGGCCAACTCCTTTTCTA Chr5:3954887..3954906 59.45 50
downstream ENSMUSE00000656231 Chr5:3956157..3956312 ATGCCGTCTCGCTGTTTAAT Chr5:3956200..3956219 59.74 45
downstream ENSMUSE00000656229 Chr5:3957624..3957800 AGTTCGGCTGAGAGTGCTGT Chr5:3957671..3957690 60.21 55
downstream ENSMUSE00000719502 Chr5:3960112..3962457 CTCCAACTTTTCTCGCTTGG Chr5:3962031..3962050 59.99 50
downstream ENSMUSE00000721568 Chr5:3960112..3962457 CTCCAACTTTTCTCGCTTGG Chr5:3962031..3962050 59.99 50
downstream ENSMUSE00000505652 Chr5:3968580..3968793 TAAGGCTGCAAAGAGCTTCC Chr5:3968703..3968722 59.73 50
downstream ENSMUSE00000703022 Chr5:3968580..3968793 TAAGGCTGCAAAGAGCTTCC Chr5:3968703..3968722 59.73 50
downstream ENSMUSE00000503624 Chr5:3970664..3970737 GACACTGCCTGTTGAAGTCG Chr5:3970715..3970734 59.47 55
downstream ENSMUSE00000703021 Chr5:3970664..3970737 GACACTGCCTGTTGAAGTCG Chr5:3970715..3970734 59.47 55
downstream ENSMUSE00000381275 Chr5:3971902..3972037 TTCTGGGCTTTGATTTTGAGA Chr5:3972011..3972031 59.81 38.1
downstream ENSMUSE00000703020 Chr5:3971902..3972037 TTCTGGGCTTTGATTTTGAGA Chr5:3972011..3972031 59.81 38.1
downstream ENSMUSE00000299575 Chr5:3972756..3972841 TGAGAGTTTGCGGCATTCTT Chr5:3972820..3972839 60.91 45
downstream ENSMUSE00000703019 Chr5:3972756..3972841 TGAGAGTTTGCGGCATTCTT Chr5:3972820..3972839 60.91 45
downstream ENSMUSE00000299561 Chr5:3975599..3975710 CTCTTCTGCCGCATTTTGTT Chr5:3975664..3975683 60.39 45
downstream ENSMUSE00000703018 Chr5:3975599..3975710 CTCTTCTGCCGCATTTTGTT Chr5:3975664..3975683 60.39 45
downstream ENSMUSE00000299549 Chr5:3976128..3976326 GCCACAGGGCTCTGTAACTC Chr5:3976224..3976243 59.87 60
downstream ENSMUSE00000703017 Chr5:3976128..3976326 GCCACAGGGCTCTGTAACTC Chr5:3976224..3976243 59.87 60
downstream ENSMUSE00000333130 Chr5:3981118..3981214 TGCCATCCACACACTCTCTT Chr5:3981209..3981228 59.26 50
downstream ENSMUSE00000703016 Chr5:3981118..3981214 TGCCATCCACACACTCTCTT Chr5:3981209..3981228 59.26 50
downstream ENSMUSE00000382496 Chr5:3992046..3992138 TTTCTTGCCTCACTTCGAATC Chr5:3992078..3992098 59.44 42.86
downstream ENSMUSE00000703015 Chr5:3992046..3992138 TTTCTTGCCTCACTTCGAATC Chr5:3992078..3992098 59.44 42.86
downstream ENSMUSE00000481796 Chr5:4001405..4001758 AATTCTTGTCCGTTGCCTCA Chr5:4001594..4001613 60.64 45
downstream ENSMUSE00000703014 Chr5:4001405..4001758 AATTCTTGTCCGTTGCCTCA Chr5:4001594..4001613 60.64 45
downstream ENSMUSE00000506559 Chr5:4003561..4003782 GCCGCATATCTTCCAACTGT Chr5:4003642..4003661 60.1 50
downstream ENSMUSE00000703013 Chr5:4003561..4003782 GCCGCATATCTTCCAACTGT Chr5:4003642..4003661 60.1 50
downstream ENSMUSE00000184844 Chr5:4004803..4004943 GTGTTTGCGTACTGCTGTGG Chr5:4004944..4004963 60.37 55
downstream ENSMUSE00000703012 Chr5:4004803..4004943 GTGTTTGCGTACTGCTGTGG Chr5:4004944..4004963 60.37 55
downstream ENSMUSE00000299683 Chr5:4005410..4005513 CAGGGCTTCTCTCCAATGTC Chr5:4005479..4005498 59.8 55
downstream ENSMUSE00000550041 Chr5:4005410..4005513 CAGGGCTTCTCTCCAATGTC Chr5:4005479..4005498 59.8 55
downstream ENSMUSE00000299676 Chr5:4008344..4008549 GATGCGTCTGCTTCTGACCT Chr5:4008517..4008536 60.56 55
downstream ENSMUSE00000703011 Chr5:4008344..4008549 GATGCGTCTGCTTCTGACCT Chr5:4008517..4008536 60.56 55
downstream ENSMUSE00000184840 Chr5:4013850..4014079 TGTTGCTATGGCAGTTCCAG Chr5:4013899..4013918 59.86 50
downstream ENSMUSE00000703010 Chr5:4013850..4014079 TGTTGCTATGGCAGTTCCAG Chr5:4013899..4013918 59.86 50
downstream ENSMUSE00000299661 Chr5:4028374..4028536 GGACTCACGCATCAACTCTG Chr5:4028421..4028440 59.42 55
downstream ENSMUSE00000703009 Chr5:4028374..4028536 GGACTCACGCATCAACTCTG Chr5:4028421..4028440 59.42 55
downstream ENSMUSE00000517054 Chr5:4029840..4030052 ACACCTCCTGCTCAAGATGC Chr5:4029935..4029954 60.42 55
downstream ENSMUSE00000703008 Chr5:4029840..4030052 ACACCTCCTGCTCAAGATGC Chr5:4029935..4029954 60.42 55
downstream ENSMUSE00000416357 Chr5:4032681..4032913 CTGAAGGTCACCACGGACTT Chr5:4032766..4032785 60.15 55
downstream ENSMUSE00000703007 Chr5:4032681..4032913 CTGAAGGTCACCACGGACTT Chr5:4032766..4032785 60.15 55
downstream ENSMUSE00000416333 Chr5:4034748..4034867 AGCCTTAAGCTGATGCTCCA Chr5:4034828..4034847 60.12 50
downstream ENSMUSE00000703006 Chr5:4034748..4034867 AGCCTTAAGCTGATGCTCCA Chr5:4034828..4034847 60.12 50
downstream ENSMUSE00000416325 Chr5:4038529..4038705 CTGAATGTCTCGCTGCAGTT Chr5:4038621..4038640 59.19 50
downstream ENSMUSE00000703005 Chr5:4038529..4038705 CTGAATGTCTCGCTGCAGTT Chr5:4038621..4038640 59.19 50
downstream ENSMUSE00000416319 Chr5:4039239..4039343 GCTCCACCTGCAACTGAACT Chr5:4039317..4039336 60.45 55
downstream ENSMUSE00000703004 Chr5:4039239..4039343 GCTCCACCTGCAACTGAACT Chr5:4039317..4039336 60.45 55
downstream ENSMUSE00000416314 Chr5:4043918..4044070 TCCTGGACCTCATCGTTCTT Chr5:4043991..4044010 59.65 50
downstream ENSMUSE00000703003 Chr5:4043918..4044070 TCCTGGACCTCATCGTTCTT Chr5:4043991..4044010 59.65 50
downstream ENSMUSE00000416308 Chr5:4044799..4044978 TCATGGCAAACCCAAGTTTT Chr5:4044832..4044851 60.34 40
downstream ENSMUSE00000703002 Chr5:4044799..4044978 TCATGGCAAACCCAAGTTTT Chr5:4044832..4044851 60.34 40
downstream ENSMUSE00000416301 Chr5:4045898..4046941 GTGGAACGGCACATACTCCT Chr5:4046653..4046672 60 55
downstream ENSMUSE00000703001 Chr5:4045898..4046941 GTGGAACGGCACATACTCCT Chr5:4046653..4046672 60 55
downstream ENSMUSE00000416296 Chr5:4050155..4050643 TCTGAATCGCTGCGTCTCTA Chr5:4050416..4050435 59.85 50
downstream ENSMUSE00000703000 Chr5:4050155..4050643 TCTGAATCGCTGCGTCTCTA Chr5:4050416..4050435 59.85 50
downstream ENSMUSE00000416292 Chr5:4051036..4051099 No primer for this exon
downstream ENSMUSE00000702999 Chr5:4051036..4051099 No primer for this exon
downstream ENSMUSE00000416289 Chr5:4051210..4051310 TCTTCTCGGCCTTCTATTGC Chr5:4051273..4051292 59.55 50
downstream ENSMUSE00000702998 Chr5:4051210..4051310 TCTTCTCGGCCTTCTATTGC Chr5:4051273..4051292 59.55 50
downstream ENSMUSE00000416283 Chr5:4055161..4055352 AAGATTCCGAAAGCTGCTGA Chr5:4055269..4055288 60.1 45
downstream ENSMUSE00000702997 Chr5:4055161..4055352 AAGATTCCGAAAGCTGCTGA Chr5:4055269..4055288 60.1 45
downstream ENSMUSE00000416276 Chr5:4055592..4055768 AGAAGTTCACCTCGCCAGTC Chr5:4055638..4055657 59.46 55
downstream ENSMUSE00000702996 Chr5:4055592..4055768 AGAAGTTCACCTCGCCAGTC Chr5:4055638..4055657 59.46 55
downstream ENSMUSE00000416270 Chr5:4058436..4058580 TTTCCCGCCATTAATCTGAG Chr5:4058540..4058559 60.03 45
downstream ENSMUSE00000702995 Chr5:4058436..4058580 TTTCCCGCCATTAATCTGAG Chr5:4058540..4058559 60.03 45
downstream ENSMUSE00000416267 Chr5:4060282..4060495 TGCATACTGCAGTCCAGGAG Chr5:4060306..4060325 60.01 55
downstream ENSMUSE00000702994 Chr5:4060282..4060495 TGCATACTGCAGTCCAGGAG Chr5:4060306..4060325 60.01 55
downstream ENSMUSE00000416262 Chr5:4061138..4061288 AAAGCCCACTGCAGCTCTAA Chr5:4061233..4061252 60.15 50
downstream ENSMUSE00000702993 Chr5:4061138..4061288 AAAGCCCACTGCAGCTCTAA Chr5:4061233..4061252 60.15 50
downstream ENSMUSE00000339553 Chr5:4064071..4064739 TAAGTTGCGGCCTTGTTCTT Chr5:4064232..4064251 59.88 45
downstream ENSMUSE00000702992 Chr5:4064071..4064739 TAAGTTGCGGCCTTGTTCTT Chr5:4064232..4064251 59.88 45
downstream ENSMUSE00000299843 Chr5:4065181..4065386 CCACATGCTGGAGTGTCTGT Chr5:4065349..4065368 59.74 55
downstream ENSMUSE00000702991 Chr5:4065181..4065386 CCACATGCTGGAGTGTCTGT Chr5:4065349..4065368 59.74 55
downstream ENSMUSE00000299837 Chr5:4065805..4065910 GGCTGGCCAGTTAGTTTCTG Chr5:4065903..4065922 59.88 55
downstream ENSMUSE00000702990 Chr5:4065805..4065910 GGCTGGCCAGTTAGTTTCTG Chr5:4065903..4065922 59.88 55
downstream ENSMUSE00000299830 Chr5:4067740..4067922 GTGCCAGTAGCACCTGTTCA Chr5:4067904..4067923 59.9 55
downstream ENSMUSE00000702989 Chr5:4067740..4067922 GTGCCAGTAGCACCTGTTCA Chr5:4067904..4067923 59.9 55
downstream ENSMUSE00000299823 Chr5:4069007..4069207 GCAAGGCATCGTTTCGTAGT Chr5:4069169..4069188 60.28 50
downstream ENSMUSE00000702988 Chr5:4069007..4069207 GCAAGGCATCGTTTCGTAGT Chr5:4069169..4069188 60.28 50
downstream ENSMUSE00000299806 Chr5:4070299..4070531 GGGTGACGTCTTCACACTCC Chr5:4070413..4070432 60.57 60
downstream ENSMUSE00000702987 Chr5:4070299..4070531 GGGTGACGTCTTCACACTCC Chr5:4070413..4070432 60.57 60
downstream ENSMUSE00000407283 Chr5:4072615..4072700 CAGTCCAAATCCATCCCTGT Chr5:4072696..4072715 59.78 50
downstream ENSMUSE00000702986 Chr5:4072615..4072700 CAGTCCAAATCCATCCCTGT Chr5:4072696..4072715 59.78 50
downstream ENSMUSE00000332095 Chr5:4077186..4077315 GCCCACCAGGAGAATGATAG Chr5:4077230..4077249 59.51 55
downstream ENSMUSE00000702985 Chr5:4077186..4077315 GCCCACCAGGAGAATGATAG Chr5:4077230..4077249 59.51 55
downstream ENSMUSE00000364998 Chr5:4077828..4077967 TAGCTCCAAGTCGCCTTCTC Chr5:4077961..4077980 59.72 55
downstream ENSMUSE00000702984 Chr5:4077828..4077967 TAGCTCCAAGTCGCCTTCTC Chr5:4077961..4077980 59.72 55
downstream ENSMUSE00000403453 Chr5:4079659..4080204 TACTCGTCCAGCAGCACTGT Chr5:4080018..4080037 59.65 55
downstream ENSMUSE00000702983 Chr5:4079659..4080204 TACTCGTCCAGCAGCACTGT Chr5:4080018..4080037 59.65 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGATTTTGGGCAAGACT Chr5:3931442..3931462 58.2 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGAACCGTGACTGGGAAAA Chr5:3931535..3931556 59.22 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040407