Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30744
Trapped Gene
Hspa14 (ENSMUSG00000051396)
Vector Insertion
Chr 2: 3411769 - 3413992
Public Clones IST11529G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161637 (Chr2:3413836..3413991 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGATGAACAGCGCTGAAGT Chr2:3413926..3413945 59.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161637 (Chr2:3413836..3413991 -)
Downstram Exon
ENSMUSE00000161625 (Chr2:3411770..3411872 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGATGAACAGCGCTGAAGT Chr2:3413926..3413945 59.6 45 AAAAAGCGGAGAACAGAGCA Chr2:3411817..3411836 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426981 Chr2:3429906..3430028 CTGAAGGGTCCTTCGTTGAG Chr2:3429985..3430004 59.84 55
upstream ENSMUSE00000570305 Chr2:3428446..3428526 TGTTGCTTACTCGGAACGTG Chr2:3428451..3428470 59.9 50
upstream ENSMUSE00000570304 Chr2:3428287..3428369 GGACTGGCAGCAAAACAAAG Chr2:3428344..3428363 60.81 50
upstream ENSMUSE00000161641 Chr2:3420009..3420057 TCTGCAGATCCACAAGCTCA Chr2:3420037..3420056 60.71 50
upstream ENSMUSE00000161627 Chr2:3419766..3419871 ATGGGAAGTTGCGGTATGAA Chr2:3419839..3419858 60.33 45
upstream ENSMUSE00000161638 Chr2:3418320..3418410 GCAAATGACGTGGTTGTCAC Chr2:3418362..3418381 60.02 50
upstream ENSMUSE00000161640 Chr2:3416479..3416583 TTGGACAAGACCACCCTACC Chr2:3416487..3416506 59.82 55
upstream ENSMUSE00000161642 Chr2:3415294..3415455 TTGGAGGAACGTCCTTATCG Chr2:3415416..3415435 60.07 50
upstream ENSMUSE00000161637 Chr2:3413836..3413991 TTGATGAACAGCGCTGAAGT Chr2:3413926..3413945 59.6 45
upstream ENSMUSE00000161625 Chr2:3411770..3411872 TGCTCTGTTCTCCGCTTTTT Chr2:3411839..3411858 60.13 45

*** Putative Vector Insertion (Chr 2: 3411769 - 3413992) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000161634 Chr2:3408793..3409005 GACGTGCTCTCTTTCCCAAC Chr2:3408823..3408842 59.85 55
downstream ENSMUSE00000319365 Chr2:3408209..3408382 GAGTTCAAGGCAAACGGAAG Chr2:3408238..3408257 59.85 50
downstream ENSMUSE00000161629 Chr2:3406970..3407040 No primer for this exon
downstream ENSMUSE00000363565 Chr2:3406126..3406341 TCAGGATGCAACCTCAACAG Chr2:3406241..3406260 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:3413922..3413942 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGCGTGACTGGGAAAAC Chr2:3413926..3413946 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051396