Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30748
Trapped Gene
Pex2 (ENSMUSG00000027674)
Vector Insertion
Chr 3: 32981737 - 33042005
Public Clones IST14458E12 (tigm) IST14610F11 (tigm) IST14745E10 (tigm) IST14606A3 (tigm)
IST13862F4 (tigm) IST13861F4 (tigm) IST10885F5 (tigm) IST14511E10 (tigm)
IST14904G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676005 (Chr3:33041771..33042004 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTACCAGGGACACATGCAG Chr3:33041771..33041790 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676005 (Chr3:33041771..33042004 -)
Downstram Exon
ENSMUSE00000675988 (Chr3:32981738..32981957 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTACCAGGGACACATGCAG Chr3:33041771..33041790 60.59 55 CCCTGTCGTCTTCCTAAGCA Chr3:32981847..32981866 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675978 Chr3:33041771..33042169 TGTACCAGGGACACATGCAG Chr3:33041771..33041790 60.59 55
upstream ENSMUSE00000676005 Chr3:33041771..33042004 TGTACCAGGGACACATGCAG Chr3:33041771..33041790 60.59 55
upstream ENSMUSE00000675988 Chr3:32981738..32981957 GGCTCAGCTAAGCAAAGTGG Chr3:32981794..32981813 60.15 55
upstream ENSMUSE00000712362 Chr3:32981738..32981951 GGCTCAGCTAAGCAAAGTGG Chr3:32981794..32981813 60.15 55
upstream ENSMUSE00000716908 Chr3:32981738..32981951 GGCTCAGCTAAGCAAAGTGG Chr3:32981794..32981813 60.15 55

*** Putative Vector Insertion (Chr 3: 32981737 - 33042005) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568969 Chr3:32980898..32981057 TGCTGACCAGAGAACCACAG Chr3:32981014..32981033 60.02 55
downstream ENSMUSE00000675987 Chr3:32980898..32980925 No primer for this exon
downstream ENSMUSE00000675995 Chr3:32980898..32981057 TGCTGACCAGAGAACCACAG Chr3:32981014..32981033 60.02 55
downstream ENSMUSE00000429225 Chr3:32979387..32979458 CAGGTCCTCGTCACTGCTTA Chr3:32979389..32979408 59.03 55
downstream ENSMUSE00000675977 Chr3:32923618..32923722 TCCTCCCTCGGTATCTCCTT Chr3:32923636..32923655 60.03 55
downstream ENSMUSE00000592837 Chr3:32913887..32913998 TTTGGTTTCGCAGAGGAAGT Chr3:32913905..32913924 59.85 45
downstream ENSMUSE00000592836 Chr3:32906044..32906238 GAGGGACGAGCTCTTTGATG Chr3:32906116..32906135 59.95 55
downstream ENSMUSE00000592835 Chr3:32904842..32904965 GTTCGGTCACCGTGAAACTT Chr3:32904889..32904908 60.01 50
downstream ENSMUSE00000675985 Chr3:32904842..32904968 GTTCGGTCACCGTGAAACTT Chr3:32904889..32904908 60.01 50
downstream ENSMUSE00000592834 Chr3:32903226..32903322 AAGCCGACTCAGAGTTGAGG Chr3:32903233..32903252 59.6 55
downstream ENSMUSE00000592833 Chr3:32891828..32891923 CAAGGAATGGTTCCTGGAGA Chr3:32891842..32891861 60.04 50
downstream ENSMUSE00000675982 Chr3:32883913..32884001 GCAGGTTACGAGCTCCTTTTT Chr3:32883923..32883943 59.91 47.62
downstream ENSMUSE00000592832 Chr3:32857668..32857784 CGAGACGGTGACTTGGTTCT Chr3:32857658..32857677 60.3 55
downstream ENSMUSE00000592831 Chr3:32855595..32855738 CCTGAAGAATTGCAGCTTCC Chr3:32855590..32855609 59.96 50
downstream ENSMUSE00000675976 Chr3:32854788..32855738 CAAGCCAAGGGAATTGTTGT Chr3:32855451..32855470 59.97 45
downstream ENSMUSE00000592830 Chr3:32854684..32854754 AGCTGCCTGCTCATTTTCAT Chr3:32854679..32854698 59.99 45
downstream ENSMUSE00000592829 Chr3:32853250..32853447 GCCATCAGAGCCTTCAAGTT Chr3:32853384..32853403 59.43 50
downstream ENSMUSE00000592828 Chr3:32851958..32852123 CTCTGGCCGAACTGTTAAGG Chr3:32851936..32851955 59.87 55
downstream ENSMUSE00000592827 Chr3:32851393..32851550 TATCTGGAGCGGATGAAACC Chr3:32851410..32851429 60.04 50
downstream ENSMUSE00000675979 Chr3:32849552..32849795 GCTCTCAGGAGGACATCCAA Chr3:32849588..32849607 60.35 55
downstream ENSMUSE00000480799 Chr3:32849534..32849795 GCTCTCAGGAGGACATCCAA Chr3:32849588..32849607 60.35 55
downstream ENSMUSE00000675998 Chr3:32848876..32849795 ATTTGGAAGCGAGTGCAGTT Chr3:32849288..32849307 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACTCGCCAGTCTTCCTGTG Chr3:33032994..33033014 59.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTCGCCAGTCTTCCTGTG Chr3:33032994..33033014 59.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027674