Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3075
Trapped Gene
Uba3 (ENSMUSG00000030061)
Vector Insertion
Chr 6: 97136711 - 97139522
Public Clones DC0242 (sanger) DC0250 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000194791 (Chr6:97139523..97139636 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000194791 (Chr6:97139523..97139636 -)
Downstram Exon
ENSMUSE00000194785 (Chr6:97136657..97136710 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695343 Chr6:97155527..97155554 No primer for this exon
upstream ENSMUSE00000244916 Chr6:97155300..97155341 TAGAGGAGCTGCTGGCTGAG Chr6:97155302..97155321 60.97 60
upstream ENSMUSE00000244911 Chr6:97153468..97153588 GTCTGGACCCTTCACACACC Chr6:97153491..97153510 60.42 60
upstream ENSMUSE00000244909 Chr6:97151911..97151991 AGCTGGTGGCTTAGGATGTG Chr6:97151928..97151947 60.28 55
upstream ENSMUSE00000244906 Chr6:97149233..97149315 No primer for this exon
upstream ENSMUSE00000194806 Chr6:97146831..97146911 AAGATGTCGGAAGACCCAAG Chr6:97146887..97146906 59.14 50
upstream ENSMUSE00000194801 Chr6:97142735..97142778 No primer for this exon
upstream ENSMUSE00000194788 Chr6:97141520..97141584 TCATTGTATGTGGCCTGGAC Chr6:97141556..97141575 59.37 50
upstream ENSMUSE00000194797 Chr6:97141087..97141242 CCTGGAATGACCGCTTGTAT Chr6:97141118..97141137 59.96 50
upstream ENSMUSE00000194803 Chr6:97139748..97139850 GTTGCAATGGCCTAAAGAGC Chr6:97139760..97139779 59.85 50
upstream ENSMUSE00000194791 Chr6:97139523..97139636 No primer for this exon

*** Putative Vector Insertion (Chr 6: 97136711 - 97139522) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000194785 Chr6:97136657..97136710 No primer for this exon
downstream ENSMUSE00000194799 Chr6:97136231..97136267 TTGAAAACCTCAGTGGCACA Chr6:97136221..97136240 60.28 45
downstream ENSMUSE00000194793 Chr6:97136063..97136144 CAGCCCATCTACATCATTGAA Chr6:97136071..97136091 58.59 42.86
downstream ENSMUSE00000194787 Chr6:97135644..97135744 TTGGCTACATGCTGGACAGT Chr6:97135699..97135718 59.32 50
downstream ENSMUSE00000194786 Chr6:97135477..97135540 GCTGTGATAGCCGGAGACTT Chr6:97135492..97135511 59.46 55
downstream ENSMUSE00000194795 Chr6:97135335..97135389 GGCCTGGTTCGTTCTTCAAT Chr6:97135336..97135355 61.38 50
downstream ENSMUSE00000695311 Chr6:97133813..97134859 TTCTTGGATGTTCCCCTCTG Chr6:97134646..97134665 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTGTTAATCGCCTTGCAG Chr6:97139457..97139478 59.53 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCGTGACTGGGAAAACC Chr6:97139455..97139475 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030061