Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30752
Trapped Gene
Gria4 (ENSMUSG00000025892)
Vector Insertion
Chr 9: 4464113 - 4472219
Public Clones (sanger) IST14421H8 (tigm) IST10546B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000540096 (Chr9:4472012..4472218 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCTGAAATTGCGAAACA Chr9:4472118..4472137 59.82 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000540096 (Chr9:4472012..4472218 -)
Downstram Exon
ENSMUSE00000540095 (Chr9:4464114..4464484 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCTGAAATTGCGAAACA Chr9:4472118..4472137 59.82 40 CACTGGGTCCTTCTTTTCCA Chr9:4464180..4464199 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455153 Chr9:4795845..4796142 CGACTTGGAGGGCATAAAAA Chr9:4796004..4796023 60.07 45
upstream ENSMUSE00000455170 Chr9:4795187..4795363 GCAGGCAGATTGTCTTGTTG Chr9:4795242..4795261 59.44 50
upstream ENSMUSE00000153926 Chr9:4793810..4793968 GAAGCCCCTTTCAATTTGGT Chr9:4793863..4793882 60.3 45
upstream ENSMUSE00000260428 Chr9:4664768..4665007 GAGAGAGCCAGTTCGTGCTT Chr9:4664859..4664878 59.75 55
upstream ENSMUSE00000260405 Chr9:4537635..4537819 GGCATGTCAGTGCGATATGT Chr9:4537752..4537771 59.56 50
upstream ENSMUSE00000260376 Chr9:4519486..4519539 GAAGCACGTCAAAGGCTACC Chr9:4519506..4519525 59.88 55
upstream ENSMUSE00000260353 Chr9:4513223..4513381 AATGGATCGCTGGAAGAAAC Chr9:4513264..4513283 59.13 45
upstream ENSMUSE00000540099 Chr9:4503562..4503729 CCAGGGAATTGACATGGAGA Chr9:4503576..4503595 60.86 50
upstream ENSMUSE00000260319 Chr9:4502374..4502478 AAAAGCACAGGACCTCGAAA Chr9:4502375..4502394 59.85 45
upstream ENSMUSE00000260300 Chr9:4480178..4480288 CGCCTACTCTTGGCAATGAC Chr9:4480223..4480242 60.8 55
upstream ENSMUSE00000540096 Chr9:4472012..4472218 GCATCTGAAATTGCGAAACA Chr9:4472118..4472137 59.82 40
upstream ENSMUSE00000540095 Chr9:4464114..4464484 CCCAATGAGTTTGGCATCTT Chr9:4464174..4464193 59.93 45

*** Putative Vector Insertion (Chr 9: 4464113 - 4472219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540094 Chr9:4461906..4462104 ACCATACGCCTCCAACAATC Chr9:4462048..4462067 59.82 50
downstream ENSMUSE00000540092 Chr9:4456005..4456252 CTCCCACTTTCATCGTGTCA Chr9:4456038..4456057 59.68 50
downstream ENSMUSE00000540086 Chr9:4432773..4432887 TTGTCCAAGAGGCCTTGTTC Chr9:4432812..4432831 60.23 50
downstream ENSMUSE00000540091 Chr9:4427030..4427144 TCTAAGACGCCTGCCTCACT Chr9:4427072..4427091 60.16 55
downstream ENSMUSE00000540090 Chr9:4424320..4424454 CCTCTGCCCTGGACTTGTAA Chr9:4424312..4424331 60.25 55
downstream ENSMUSE00000455093 Chr9:4417896..4420316 CCTAAGGTACCCCACCCACT Chr9:4419889..4419908 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGAAGCAAAACAGGGTCA Chr9:4472246..4472266 59.29 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGAAGCAAAACAGGGTCA Chr9:4472246..4472266 59.29 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025892