Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30772
Trapped Gene
Ercc2 (ENSMUSG00000030400)
Vector Insertion
Chr 7: 19977436 - 19978597
Public Clones IST11177C12 (tigm) IST11244C4 (tigm) IST11849G1 (tigm) IST11575B8 (tigm)
IST10099E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000198491 (Chr7:19977314..19977435 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCGAAACTATGGCAACCTC Chr7:19977320..19977339 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000198491 (Chr7:19977314..19977435 +)
Downstram Exon
ENSMUSE00000198487 (Chr7:19978598..19978690 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCGAAACTATGGCAACCTC Chr7:19977320..19977339 60.07 50 CCATCCTGGGTCTCAATGAA Chr7:19978656..19978675 60.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676851 Chr7:19967380..19967408 No primer for this exon
upstream ENSMUSE00000676864 Chr7:19967388..19967408 No primer for this exon
upstream ENSMUSE00000500776 Chr7:19967389..19967408 No primer for this exon
upstream ENSMUSE00000369577 Chr7:19967628..19967727 TACCCGGAGCAGTTCTCCTA Chr7:19967674..19967693 59.83 55
upstream ENSMUSE00000233546 Chr7:19969293..19969370 GTGTCCCTATTGGCCCTGAT Chr7:19969335..19969354 61.11 55
upstream ENSMUSE00000198484 Chr7:19969448..19969510 GACCGTGCCAGAGATTGAGA Chr7:19969489..19969508 61.38 55
upstream ENSMUSE00000198498 Chr7:19969651..19969764 GCTTCTACGAGCAGCAGGAG Chr7:19969679..19969698 60.44 60
upstream ENSMUSE00000198497 Chr7:19970972..19971088 TGGGAAGTGTCACAGCCTAA Chr7:19971004..19971023 59.29 50
upstream ENSMUSE00000233519 Chr7:19971179..19971295 No primer for this exon
upstream ENSMUSE00000233508 Chr7:19972056..19972179 AGGCTGTTGTGGTCTTCGAT Chr7:19972144..19972163 59.73 50
upstream ENSMUSE00000198492 Chr7:19972281..19972377 CCCTACAGAAGACCGTGCTC Chr7:19972356..19972375 59.87 60
upstream ENSMUSE00000676850 Chr7:19972324..19972377 CCCTACAGAAGACCGTGCTC Chr7:19972356..19972375 59.87 60
upstream ENSMUSE00000198486 Chr7:19972462..19972595 GATCAAGGAGACGGATGAGC Chr7:19972462..19972481 59.77 55
upstream ENSMUSE00000198493 Chr7:19972678..19972846 GTATGTCAAGTGGCGTCTGC Chr7:19972742..19972761 59.32 55
upstream ENSMUSE00000198488 Chr7:19973489..19973607 GCTAACTTCGCCACTCTCGT Chr7:19973571..19973590 59.64 55
upstream ENSMUSE00000198496 Chr7:19975456..19975525 ATTGAGCCCTTTGACGACAG Chr7:19975470..19975489 60.26 50
upstream ENSMUSE00000198502 Chr7:19975598..19975667 AGCGCTTCCAGTCTGTCATC Chr7:19975636..19975655 60.56 55
upstream ENSMUSE00000198500 Chr7:19975748..19975849 GTCCCCACTGGACATCTACC Chr7:19975753..19975772 59.23 60
upstream ENSMUSE00000198499 Chr7:19976876..19976939 CAGGTAGCAATCAGCTCCAA Chr7:19976897..19976916 59.02 50
upstream ENSMUSE00000198491 Chr7:19977314..19977435 TCCGAAACTATGGCAACCTC Chr7:19977320..19977339 60.07 50

*** Putative Vector Insertion (Chr 7: 19977436 - 19978597) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000198487 Chr7:19978598..19978690 CCATCCTGGGTCTCAATGAA Chr7:19978656..19978675 60.86 50
downstream ENSMUSE00000198489 Chr7:19978782..19978854 AGCCACTGAGAGCAGAATGG Chr7:19978826..19978845 60.56 55
downstream ENSMUSE00000233441 Chr7:19978979..19979049 TGAGAATTCGGCTCTGGGTA Chr7:19979050..19979069 60.73 50
downstream ENSMUSE00000233431 Chr7:19979125..19979268 CGTTCTCTCGGATCTGGAAC Chr7:19979173..19979192 59.8 55
downstream ENSMUSE00000233419 Chr7:19979388..19979531 GGAAGTACTTGGCGACCTGT Chr7:19979505..19979524 59.21 55
downstream ENSMUSE00000515143 Chr7:19979701..19981041 TCCGTGACATCAGTCAGAGC Chr7:19980374..19980393 59.99 55
downstream ENSMUSE00000676849 Chr7:19979701..19981043 TCCGTGACATCAGTCAGAGC Chr7:19980374..19980393 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030400