Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30776
Trapped Gene
EG433882 (ENSMUSG00000067285)
Vector Insertion
Chr 5: 42459318 - 42596011
Public Clones IST14315E1 (tigm) IST10887E8 (tigm) IST10562B10 (tigm) IST12031D7 (tigm)
IST14317G8 (tigm) IST13610E5 (tigm) IST10092H5 (tigm) IST14855B6 (tigm)
IST14328A7 (tigm) IST12775E12 (tigm) IST14427D1 (tigm) IST11024E10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490098 (Chr5:42459199..42459317 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGGAGGAGAGCGTACTGG Chr5:42459289..42459308 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490098 (Chr5:42459199..42459317 +)
Downstram Exon
ENSMUSE00000427613 (Chr5:42596012..42596220 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGGAGGAGAGCGTACTGG Chr5:42459289..42459308 60.39 55 TCTTCTGTCAGGAGGCAGGT Chr5:42596062..42596081 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490098 Chr5:42459199..42459317 TTTGGAGGAGAGCGTACTGG Chr5:42459289..42459308 60.39 55

*** Putative Vector Insertion (Chr 5: 42459318 - 42596011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000427613 Chr5:42596012..42596220 TCTTCTGTCAGGAGGCAGGT Chr5:42596062..42596081 59.99 55
downstream ENSMUSE00000653719 Chr5:42605836..42608023 GTGTCGTTGTGTGGAAGTGG Chr5:42605987..42606006 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:42552368..42552388 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTAGAGCCTCAGCCTTTC Chr5:42576288..42576308 60.35 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067285