Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30782
Trapped Gene
Lmbrd2 (ENSMUSG00000039704)
Vector Insertion
Chr 15: 9087180 - 9095543
Public Clones IST14232C4 (tigm) IST10336E6 (tigm) IST10873D2 (tigm) IST14958A9 (tigm)
IST14232C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270169 (Chr15:9086969..9087179 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCGGTCATACTGGAATGG Chr15:9087060..9087079 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270169 (Chr15:9086969..9087179 +)
Downstram Exon
ENSMUSE00000270162 (Chr15:9095544..9095618 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCGGTCATACTGGAATGG Chr15:9087060..9087079 60.33 55 CTTCCTCAGTGGGTGGTTGT Chr15:9095597..9095616 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440374 Chr15:9070377..9070496 TTCTGAGTCCCTTCCAGACG Chr15:9070457..9070476 60.38 55
upstream ENSMUSE00000410796 Chr15:9078732..9078961 CATGAGTCAGTTTGGCTGGA Chr15:9078750..9078769 59.83 50
upstream ENSMUSE00000370306 Chr15:9079211..9079308 CAGCCCTCCTGAAAATACCA Chr15:9079249..9079268 60.07 50
upstream ENSMUSE00000270229 Chr15:9081240..9081335 ATGTTTCAAGCCGTGGAGTT Chr15:9081249..9081268 59.6 45
upstream ENSMUSE00000270223 Chr15:9085962..9086129 ATCACCGGCAAGATCAAAAC Chr15:9086011..9086030 59.94 45
upstream ENSMUSE00000270169 Chr15:9086969..9087179 CCTCGGTCATACTGGAATGG Chr15:9087060..9087079 60.33 55

*** Putative Vector Insertion (Chr 15: 9087180 - 9095543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000270162 Chr15:9095544..9095618 CTTCCTCAGTGGGTGGTTGT Chr15:9095597..9095616 60 55
downstream ENSMUSE00000270154 Chr15:9100853..9100966 GGTAGGTATTGCGCTTTTCG Chr15:9100934..9100953 59.74 50
downstream ENSMUSE00000270149 Chr15:9101813..9101996 GAATCTGCCATTGCACTTGA Chr15:9101867..9101886 59.81 45
downstream ENSMUSE00000650212 Chr15:9104880..9105061 CAAGGGTCCTGTGAAACCAT Chr15:9104930..9104949 59.82 50
downstream ENSMUSE00000270201 Chr15:9105542..9105675 CATCGGTCTGATGGTGTGAG Chr15:9105653..9105672 60.11 55
downstream ENSMUSE00000505076 Chr15:9107408..9107513 CCATATGGGTCAATCCCAAG Chr15:9107469..9107488 60.01 50
downstream ENSMUSE00000270190 Chr15:9108018..9108115 No primer for this exon
downstream ENSMUSE00000270142 Chr15:9112241..9112344 CATGAACTGCTGGAAACCAA Chr15:9112289..9112308 59.69 45
downstream ENSMUSE00000270138 Chr15:9113666..9113712 TCACCTTCCTCTTGTCTTTGC Chr15:9113701..9113721 59.46 47.62
downstream ENSMUSE00000395218 Chr15:9116352..9116457 TCTGTTCCGAGTGGAATCCT Chr15:9116405..9116424 59.65 50
downstream ENSMUSE00000386690 Chr15:9124431..9124557 AGCCCTGGTGTATTTGGATG Chr15:9124453..9124472 59.81 50
downstream ENSMUSE00000563716 Chr15:9126412..9128074 GAGAAACTGCCCTGGACAAG Chr15:9127889..9127908 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGAAGAGAATTTGGAGGA Chr15:9087150..9087171 59.94 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGTCGTGACTGGGAAAACC Chr15:9087226..9087247 61.36 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039704