Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30786
Trapped Gene
Atn1 (ENSMUSG00000004263)
Vector Insertion
Chr 6: 124695656 - 124698008
Public Clones IST10370G11 (tigm) IST15047C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000500560 (Chr6:124696038..124698007 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000500560 (Chr6:124696038..124698007 -)
Downstram Exon
ENSMUSE00000195660 (Chr6:124695657..124695879 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000549291 Chr6:124706314..124706505 No primer for this exon
upstream ENSMUSE00000349938 Chr6:124699765..124699939 No primer for this exon
upstream ENSMUSE00000248010 Chr6:124699480..124699617 No primer for this exon
upstream ENSMUSE00000248003 Chr6:124699254..124699367 No primer for this exon
upstream ENSMUSE00000500560 Chr6:124696038..124698007 No primer for this exon
upstream ENSMUSE00000195660 Chr6:124695657..124695879 No primer for this exon

*** Putative Vector Insertion (Chr 6: 124695656 - 124698008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000506947 Chr6:124694738..124695434 No primer for this exon
downstream ENSMUSE00000195659 Chr6:124693766..124693909 No primer for this exon
downstream ENSMUSE00000195654 Chr6:124693248..124693428 No primer for this exon
downstream ENSMUSE00000502626 Chr6:124692564..124693123 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCTCCCTCGGATCTGGAC Chr6:124697967..124697987 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCTCCCTCGGATCTGGAC Chr6:124697967..124697987 60.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004263