Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3079
Trapped Gene
Helz (ENSMUSG00000020721)
Vector Insertion
Chr 11: 107531986 - 107532360
Public Clones DC0235 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322856 (Chr11:107531349..107531985 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322856 (Chr11:107531349..107531985 +)
Downstram Exon
ENSMUSE00000513753 (Chr11:107532361..107532595 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646745 Chr11:107409270..107409295 No primer for this exon
upstream ENSMUSE00000483326 Chr11:107409274..107409295 No primer for this exon
upstream ENSMUSE00000670998 Chr11:107409282..107409295 No primer for this exon
upstream ENSMUSE00000451387 Chr11:107410660..107410715 No primer for this exon
upstream ENSMUSE00000646744 Chr11:107416833..107416889 No primer for this exon
upstream ENSMUSE00000485768 Chr11:107436252..107436479 No primer for this exon
upstream ENSMUSE00000717635 Chr11:107436252..107436479 No primer for this exon
upstream ENSMUSE00000490303 Chr11:107439177..107439213 No primer for this exon
upstream ENSMUSE00000476268 Chr11:107454020..107454144 No primer for this exon
upstream ENSMUSE00000488696 Chr11:107456453..107456509 No primer for this exon
upstream ENSMUSE00000489640 Chr11:107460464..107460515 No primer for this exon
upstream ENSMUSE00000464405 Chr11:107461590..107461665 No primer for this exon
upstream ENSMUSE00000465277 Chr11:107463624..107463822 No primer for this exon
upstream ENSMUSE00000463402 Chr11:107464250..107464357 No primer for this exon
upstream ENSMUSE00000515186 Chr11:107465380..107465677 No primer for this exon
upstream ENSMUSE00000466985 Chr11:107475165..107475432 No primer for this exon
upstream ENSMUSE00000473629 Chr11:107480297..107480630 No primer for this exon
upstream ENSMUSE00000468969 Chr11:107481398..107481528 No primer for this exon
upstream ENSMUSE00000460723 Chr11:107487849..107488028 No primer for this exon
upstream ENSMUSE00000474525 Chr11:107488664..107488768 No primer for this exon
upstream ENSMUSE00000646736 Chr11:107488667..107488768 No primer for this exon
upstream ENSMUSE00000499887 Chr11:107493486..107493664 No primer for this exon
upstream ENSMUSE00000346033 Chr11:107496294..107496412 No primer for this exon
upstream ENSMUSE00000396126 Chr11:107497480..107497625 No primer for this exon
upstream ENSMUSE00000352961 Chr11:107499094..107499241 No primer for this exon
upstream ENSMUSE00000347637 Chr11:107507364..107507547 No primer for this exon
upstream ENSMUSE00000387812 Chr11:107510426..107510654 No primer for this exon
upstream ENSMUSE00000344638 Chr11:107517358..107517562 No primer for this exon
upstream ENSMUSE00000108659 Chr11:107522409..107522460 No primer for this exon
upstream ENSMUSE00000108690 Chr11:107523156..107523346 No primer for this exon
upstream ENSMUSE00000108662 Chr11:107524922..107525129 No primer for this exon
upstream ENSMUSE00000108658 Chr11:107527313..107527392 No primer for this exon
upstream ENSMUSE00000322856 Chr11:107531349..107531985 No primer for this exon

*** Putative Vector Insertion (Chr 11: 107531986 - 107532360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000513753 Chr11:107532361..107532595 No primer for this exon
downstream ENSMUSE00000646728 Chr11:107532361..107533601 No primer for this exon
downstream ENSMUSE00000401493 Chr11:107533843..107534359 No primer for this exon
downstream ENSMUSE00000108661 Chr11:107546605..107546857 No primer for this exon
downstream ENSMUSE00000502524 Chr11:107547699..107548257 No primer for this exon
downstream ENSMUSE00000670997 Chr11:107547699..107555140 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGAAGTGTCCCCGGTTA Chr11:107532012..107532032 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGAAGTGTCCCCGGTTAT Chr11:107532013..107532033 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020721