Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30794
Trapped Gene
BX119993.9 (ENSMUSG00000083294)
Vector Insertion
Chr X: 122736502 - 122770381
Public Clones IST13899B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721014 (ChrX:122770341..122770380 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721014 (ChrX:122770341..122770380 -)
Downstram Exon
ENSMUSE00000711679 (ChrX:122736503..122737163 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAAGCATGGGGTTGTTCAAG ChrX:122736987..122737006 59.97 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710632 ChrX:122777607..122777722 ATGCATGGAACGAGAAAAGG ChrX:122777649..122777668 60.07 45
upstream ENSMUSE00000721014 ChrX:122770341..122770380 No primer for this exon
upstream ENSMUSE00000711679 ChrX:122736503..122737163 CTTGAACAACCCCATGCTTT ChrX:122737009..122737028 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTGCTGGGTGAGTATGT ChrX:122749329..122749349 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTGATCGTGACTGGGAAAA ChrX:122749316..122749337 59.54 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000083294