Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30796
Trapped Gene
Scrt2 (ENSMUSG00000060257)
Vector Insertion
Chr 2: 151907919 - 151918797
Public Clones (ggtc) IST12576A11 (tigm) IST14880D2 (tigm) IST10385A4 (tigm) IST10385A4 (tigm)
IST12576A11 (tigm) IST14528C1 (tigm) IST13095A10 (tigm) IST10956B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518758 (Chr2:151907265..151907918 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCGCTGAACAGTTCCAT Chr2:151907466..151907485 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518758 (Chr2:151907265..151907918 +)
Downstram Exon
ENSMUSE00000517880 (Chr2:151918798..151921538 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCGCTGAACAGTTCCAT Chr2:151907466..151907485 60.02 50 GTCAGGTGGAATCGTGTGTG Chr2:151920215..151920234 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518758 Chr2:151907265..151907918 AGAGCGCTGAACAGTTCCAT Chr2:151907466..151907485 60.02 50

*** Putative Vector Insertion (Chr 2: 151907919 - 151918797) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517880 Chr2:151918798..151921538 GTCAGGTGGAATCGTGTGTG Chr2:151920215..151920234 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCACATAATCGCCTTGCAG Chr2:151907964..151907984 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCCACAGATAGGACGTG Chr2:151907954..151907974 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060257