Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30801
Trapped Gene
Dhdh (ENSMUSG00000011382)
Vector Insertion
Chr 7: 52728932 - 52731123
Public Clones IST14666F5 (tigm) IST12475C3 (tigm) IST12409G6 (tigm) IST13443A5 (tigm)
IST13378H8 (tigm) IST14666F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203814 (Chr7:52730975..52731122 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203814 (Chr7:52730975..52731122 -)
Downstram Exon
ENSMUSE00000350626 (Chr7:52728933..52730745 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344844 Chr7:52744044..52744166 No primer for this exon
upstream ENSMUSE00000203813 Chr7:52743430..52743541 No primer for this exon
upstream ENSMUSE00000203807 Chr7:52742111..52742274 No primer for this exon
upstream ENSMUSE00000203811 Chr7:52737159..52737411 No primer for this exon
upstream ENSMUSE00000203806 Chr7:52734379..52734503 No primer for this exon
upstream ENSMUSE00000203814 Chr7:52730975..52731122 No primer for this exon
upstream ENSMUSE00000350626 Chr7:52728933..52730745 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGGTGAATGGAGAGAGGA Chr7:52731072..52731092 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGGTGAATGGAGAGAGGA Chr7:52731072..52731092 60.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011382