Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30824
Trapped Gene
Zfp385a (ENSMUSG00000000552)
Vector Insertion
Chr 15: 103148379 - 103150832
Public Clones IST12690A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000548698 (Chr15:103150721..103150831 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000548698 (Chr15:103150721..103150831 -)
Downstram Exon
ENSMUSE00000548692 (Chr15:103148380..103148542 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355071 Chr15:103170478..103170524 No primer for this exon
upstream ENSMUSE00000548703 Chr15:103163496..103163632 No primer for this exon
upstream ENSMUSE00000548698 Chr15:103150721..103150831 No primer for this exon
upstream ENSMUSE00000548692 Chr15:103148380..103148542 No primer for this exon

*** Putative Vector Insertion (Chr 15: 103148379 - 103150832) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000548689 Chr15:103146313..103146555 No primer for this exon
downstream ENSMUSE00000645678 Chr15:103146154..103146227 No primer for this exon
downstream ENSMUSE00000645677 Chr15:103146117..103146149 No primer for this exon
downstream ENSMUSE00000645676 Chr15:103146058..103146114 No primer for this exon
downstream ENSMUSE00000548684 Chr15:103145792..103145887 No primer for this exon
downstream ENSMUSE00000548637 Chr15:103144326..103145656 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCTGTGCTCTCCCACACT Chr15:103150794..103150814 60.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTGTGCTCTCCCACACT Chr15:103150794..103150814 60.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000552