Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30840
Trapped Gene
Pnpla6 (ENSMUSG00000004565)
Vector Insertion
Chr 8: 3517656 - 3521274
Public Clones IST12082E10 (tigm) IST13650G7 (tigm) IST10024G4 (tigm) IST11573C2 (tigm)
IST10605F5 (tigm) IST14243D3 (tigm) IST11182E6 (tigm) IST13173D11 (tigm)
IST14090A5 (tigm) IST13786C3 (tigm) IST11257A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611153 (Chr8:3517558..3517655 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611153 (Chr8:3517558..3517655 +)
Downstram Exon
ENSMUSE00000210002 (Chr8:3521275..3521415 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611157 Chr8:3515384..3515556 No primer for this exon
upstream ENSMUSE00000686582 Chr8:3515425..3515556 No primer for this exon
upstream ENSMUSE00000686581 Chr8:3516510..3516568 No primer for this exon
upstream ENSMUSE00000611156 Chr8:3516681..3516749 No primer for this exon
upstream ENSMUSE00000611155 Chr8:3517077..3517164 No primer for this exon
upstream ENSMUSE00000611154 Chr8:3517325..3517407 No primer for this exon
upstream ENSMUSE00000611153 Chr8:3517558..3517655 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3517656 - 3521274) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210002 Chr8:3521275..3521415 No primer for this exon
downstream ENSMUSE00000210011 Chr8:3521508..3521667 No primer for this exon
downstream ENSMUSE00000210001 Chr8:3522101..3522181 No primer for this exon
downstream ENSMUSE00000210003 Chr8:3522277..3522405 No primer for this exon
downstream ENSMUSE00000209956 Chr8:3522588..3522668 No primer for this exon
downstream ENSMUSE00000209974 Chr8:3522759..3522924 No primer for this exon
downstream ENSMUSE00000209985 Chr8:3523258..3523341 No primer for this exon
downstream ENSMUSE00000232852 Chr8:3523758..3523867 No primer for this exon
downstream ENSMUSE00000232846 Chr8:3523999..3524166 No primer for this exon
downstream ENSMUSE00000209968 Chr8:3524252..3524329 No primer for this exon
downstream ENSMUSE00000209983 Chr8:3530962..3531167 No primer for this exon
downstream ENSMUSE00000210013 Chr8:3531429..3531560 No primer for this exon
downstream ENSMUSE00000209960 Chr8:3531638..3531761 No primer for this exon
downstream ENSMUSE00000209999 Chr8:3532003..3532116 No primer for this exon
downstream ENSMUSE00000209990 Chr8:3532352..3532427 No primer for this exon
downstream ENSMUSE00000210005 Chr8:3534530..3534670 No primer for this exon
downstream ENSMUSE00000209994 Chr8:3534832..3534895 No primer for this exon
downstream ENSMUSE00000442730 Chr8:3535462..3535630 No primer for this exon
downstream ENSMUSE00000209998 Chr8:3535820..3536002 No primer for this exon
downstream ENSMUSE00000209955 Chr8:3536543..3536661 No primer for this exon
downstream ENSMUSE00000209966 Chr8:3536863..3537019 No primer for this exon
downstream ENSMUSE00000209981 Chr8:3537249..3537365 No primer for this exon
downstream ENSMUSE00000542356 Chr8:3537451..3537520 No primer for this exon
downstream ENSMUSE00000542355 Chr8:3537969..3538085 No primer for this exon
downstream ENSMUSE00000210009 Chr8:3541291..3541592 No primer for this exon
downstream ENSMUSE00000232745 Chr8:3542298..3542414 No primer for this exon
downstream ENSMUSE00000209954 Chr8:3542845..3542941 No primer for this exon
downstream ENSMUSE00000209996 Chr8:3543067..3543176 No primer for this exon
downstream ENSMUSE00000542349 Chr8:3543954..3544266 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTCAGCTCACACCGTAAT Chr8:3517691..3517711 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTATGAGACGGGTCAGCTC Chr8:3517681..3517701 59.69 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004565