Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30846
Trapped Gene
Mast4 (ENSMUSG00000034751)
Vector Insertion
Chr 13: 103643910 - 103815634
Public Clones IST14975H3 (tigm) IST13071A10 (tigm) IST10556A7 (tigm) IST14975H3 (tigm)
IST15033H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315081 (Chr13:103815602..103815633 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCCCCGAAGAGGAAGTCT Chr13:103815602..103815621 62.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315081 (Chr13:103815602..103815633 -)
Downstram Exon
ENSMUSE00000347947 (Chr13:103643911..103643999 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCCCCGAAGAGGAAGTCT Chr13:103815602..103815621 62.01 60 TCAAACTCTTCCGGTTGCTT Chr13:103643949..103643968 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355050 Chr13:104123916..104124541 CTCTGGCTCGGAAACTCTGT Chr13:104124128..104124147 59.6 55
upstream ENSMUSE00000398403 Chr13:103961483..103961636 GCCTCGGAAAATCACTGAAG Chr13:103961550..103961569 59.81 50
upstream ENSMUSE00000315051 Chr13:103930243..103930367 No primer for this exon
upstream ENSMUSE00000315081 Chr13:103815602..103815633 CTCCCCCGAAGAGGAAGTCT Chr13:103815602..103815621 62.01 60
upstream ENSMUSE00000347947 Chr13:103643911..103643999 AAGCAACCGGAAGAGTTTGA Chr13:103643971..103643990 59.85 45

*** Putative Vector Insertion (Chr 13: 103643910 - 103815634) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639996 Chr13:103600581..103600650 TCCTCGCAAATGAGAAATGG Chr13:103600560..103600579 61.11 45
downstream ENSMUSE00000639995 Chr13:103594722..103594800 TGGAGCTTGGGGTATTTGTC Chr13:103594708..103594727 59.93 50
downstream ENSMUSE00000639994 Chr13:103588126..103588283 TGGCTGGTATGGTAGCTGGT Chr13:103588214..103588233 60.54 55
downstream ENSMUSE00000639993 Chr13:103586166..103586241 No primer for this exon
downstream ENSMUSE00000639992 Chr13:103584049..103584258 AGACGCTCTTCCATCTGAGC Chr13:103584211..103584230 59.71 55
downstream ENSMUSE00000639991 Chr13:103579043..103579144 CGGGCAATGACAATTAGGAT Chr13:103579046..103579065 59.78 45
downstream ENSMUSE00000639964 Chr13:103577397..103577529 TTTTGATTCCTTGGCCTTCTT Chr13:103577432..103577452 60.06 38.1
downstream ENSMUSE00000639963 Chr13:103573425..103573492 TCGTAATTCCCCAACTGAGC Chr13:103573446..103573465 60.07 50
downstream ENSMUSE00000315121 Chr13:103571240..103571325 GGGGTTTCCTTCGAAGTCTC Chr13:103571267..103571286 60.05 55
downstream ENSMUSE00000315338 Chr13:103564266..103564474 GGGTTCTCTGCGAAAGTCAG Chr13:103564315..103564334 59.99 55
downstream ENSMUSE00000490338 Chr13:103562535..103562673 GGTCTCGGCGAAATACATTC Chr13:103562575..103562594 59.53 50
downstream ENSMUSE00000483603 Chr13:103560803..103560935 No primer for this exon
downstream ENSMUSE00000476412 Chr13:103559849..103560014 CTGGAGTGTCCCCAAAGAAA Chr13:103559854..103559873 60.08 50
downstream ENSMUSE00000315304 Chr13:103557951..103558052 TGCCTGAGGAGCAAGGTAAT Chr13:103557955..103557974 59.84 50
downstream ENSMUSE00000398975 Chr13:103551375..103551497 CGATTCCAGTTGGGGAATAA Chr13:103551378..103551397 59.76 45
downstream ENSMUSE00000399139 Chr13:103551040..103551152 CGGTGAAGTCCTCATCGTTT Chr13:103551062..103551081 60.11 50
downstream ENSMUSE00000381695 Chr13:103549103..103549230 GATGGCAACGTTGTGCTTTT Chr13:103549120..103549139 61.07 45
downstream ENSMUSE00000315280 Chr13:103548582..103548817 TCCCCATCTGTCGAAATAGC Chr13:103548697..103548716 60.04 50
downstream ENSMUSE00000639962 Chr13:103544136..103544336 TGTGCTTTCTAAGCGCTGTC Chr13:103544187..103544206 59.37 50
downstream ENSMUSE00000315267 Chr13:103541461..103541690 CCAGACGATATGGTGCACTG Chr13:103541439..103541458 60.14 55
downstream ENSMUSE00000315263 Chr13:103540594..103540716 GCTCTCCGTTGATGTGTGTG Chr13:103540619..103540638 60.32 55
downstream ENSMUSE00000315257 Chr13:103532026..103532162 CTGGTCCCGTTTTGATTGAT Chr13:103532077..103532096 59.79 45
downstream ENSMUSE00000639961 Chr13:103529278..103529459 CTGACGGAAAATCGGGAGTA Chr13:103529256..103529275 60.07 50
downstream ENSMUSE00000639960 Chr13:103526421..103528977 AGGTCCAGACAGGAGAGCAA Chr13:103527487..103527506 59.99 55
downstream ENSMUSE00000639959 Chr13:103525088..103526375 CAATGATTGAGACCCGACCT Chr13:103526079..103526098 59.93 50
downstream ENSMUSE00000679912 Chr13:103524943..103524961 No primer for this exon
downstream ENSMUSE00000569169 Chr13:103524891..103524941 ACTACTGGGAAGGCATCTGG Chr13:103524878..103524897 59.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCAGATAAACCCAGAGGT Chr13:103803656..103803676 60.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATGCTCAAGCGTGACTGG Chr13:103803574..103803594 61.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034751