Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30867
Trapped Gene
Nkrf (ENSMUSG00000044149)
Vector Insertion
Chr X: 34431619 - 34442895
Public Clones IST11991E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000334675 (ChrX:34442731..34442894 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACAAACCACGTTTTCCTG ChrX:34442739..34442758 60.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000334675 (ChrX:34442731..34442894 -)
Downstram Exon
ENSMUSE00000377853 (ChrX:34431620..34431750 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACAAACCACGTTTTCCTG ChrX:34442739..34442758 60.39 50 AGGTAGCGTTTTTGGCCTTT ChrX:34431612..34431631 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000334675 ChrX:34442731..34442894 GGACAAACCACGTTTTCCTG ChrX:34442739..34442758 60.39 50
upstream ENSMUSE00000377853 ChrX:34431620..34431750 AAGGCCAAAAACGCTACCTT ChrX:34431633..34431652 60.13 45

*** Putative Vector Insertion (Chr X: 34431619 - 34442895) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363913 ChrX:34427539..34430507 TCAGAGCGGGCATAGTTTCT ChrX:34428751..34428770 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAAAATAATCGCCTTGCAG ChrX:34439830..34439851 60.21 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAAAACGTGACTGGGAAAA ChrX:34439830..34439851 60.5 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044149