Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3087
Trapped Gene
Bysl (ENSMUSG00000023988)
Vector Insertion
Chr 17: 47743951 - 47747855
Public Clones DC0174 (sanger) XH849 (baygenomics) (ggtc) CMHD-GT_324A10-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000607021 (Chr17:47747856..47748167 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTAAGCAGACGGATTTTGC Chr17:47747946..47747965 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000607021 (Chr17:47747856..47748167 -)
Downstram Exon
ENSMUSE00000320110 (Chr17:47743788..47743950 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTAAGCAGACGGATTTTGC Chr17:47747946..47747965 59.99 50 TCACGGGAGGATTCTTGTTC Chr17:47743767..47743786 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000607021 Chr17:47747856..47748167 GCTAAGCAGACGGATTTTGC Chr17:47747946..47747965 59.99 50

*** Putative Vector Insertion (Chr 17: 47743951 - 47747855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320110 Chr17:47743788..47743950 TCACGGGAGGATTCTTGTTC Chr17:47743767..47743786 60.05 50
downstream ENSMUSE00000136963 Chr17:47741204..47741342 TAGGGAAGCCCGATACCTCT Chr17:47741232..47741251 60.05 55
downstream ENSMUSE00000136967 Chr17:47740805..47740938 TTCCCACTGCGGTACTTACA Chr17:47740891..47740910 59.19 50
downstream ENSMUSE00000136966 Chr17:47739587..47739747 CTTGAGCGCCATGTAGAGGT Chr17:47739599..47739618 60.42 55
downstream ENSMUSE00000136965 Chr17:47739341..47739443 CTTCACGGAGGGTACAGGTG Chr17:47739374..47739393 60.56 60
downstream ENSMUSE00000607020 Chr17:47738186..47738847 CCGGTTAGCTTCCAGAAGTG Chr17:47738284..47738303 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGTGACAAGGGGTGGAG Chr17:47747834..47747854 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGGGTGGAGTCGTGAGTT Chr17:47744825..47744845 60.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATGGCTCAACCCACCTATCA Chr17:47745127..47745147 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGGCTCAACCCACCTATCA Chr17:47745127..47745147 60.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023988