Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30875
Trapped Gene
Lrrc49 (ENSMUSG00000047766)
Vector Insertion
Chr 9: 60469375 - 60497349
Public Clones IST12733H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000463540 (Chr9:60497287..60497348 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAATTTGCCCTGCCTCCAA Chr9:60497319..60497338 61.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000463540 (Chr9:60497287..60497348 -)
Downstram Exon
ENSMUSE00000487433 (Chr9:60469376..60469523 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAATTTGCCCTGCCTCCAA Chr9:60497319..60497338 61.67 45 TGTCCGAGAGGGAAGTTGAC Chr9:60469455..60469474 60.24 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513652 Chr9:60535619..60535708 AAATATCGCTCCGTTTCTGG Chr9:60535635..60535654 59.18 45
upstream ENSMUSE00000533292 Chr9:60535619..60535718 AAATATCGCTCCGTTTCTGG Chr9:60535635..60535654 59.18 45
upstream ENSMUSE00000697828 Chr9:60535218..60535341 GACTGGCAACAGAAATGTCG Chr9:60535242..60535261 59.29 50
upstream ENSMUSE00000516170 Chr9:60534946..60535002 No primer for this exon
upstream ENSMUSE00000510522 Chr9:60532842..60532929 GCATGACCTGGAGAGGAACT Chr9:60532857..60532876 59.26 55
upstream ENSMUSE00000428176 Chr9:60528312..60528509 CACCTTCAAAGCCGAGAATC Chr9:60528349..60528368 59.81 50
upstream ENSMUSE00000469913 Chr9:60527876..60527978 CCTATTCTCCAGCGCTCTTC Chr9:60527918..60527937 59.17 55
upstream ENSMUSE00000465161 Chr9:60524887..60525090 TCTGAAATCCCTTCGTGTCC Chr9:60524906..60524925 60.05 50
upstream ENSMUSE00000464266 Chr9:60519102..60519168 CTTGGACCTTCATGGAAATCA Chr9:60519103..60519123 59.92 42.86
upstream ENSMUSE00000474413 Chr9:60514096..60514239 GGAACTTAACCTTCGGCACA Chr9:60514113..60514132 60.11 50
upstream ENSMUSE00000463540 Chr9:60497287..60497348 ATAATTTGCCCTGCCTCCAA Chr9:60497319..60497338 61.67 45
upstream ENSMUSE00000697824 Chr9:60497287..60497608 CTCCGAGTCCAGAGGAGATG Chr9:60497474..60497493 59.94 60
upstream ENSMUSE00000487433 Chr9:60469376..60469523 GGCAACCCAATAGCTCAAGA Chr9:60469446..60469465 60.21 50
upstream ENSMUSE00000697820 Chr9:60469376..60469523 GGCAACCCAATAGCTCAAGA Chr9:60469446..60469465 60.21 50

*** Putative Vector Insertion (Chr 9: 60469375 - 60497349) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218368 Chr9:60462901..60462984 CAGCAAGGACTGCTTGTGAC Chr9:60462882..60462901 59.62 55
downstream ENSMUSE00000218372 Chr9:60458065..60458228 TCGAGCGACATTGTTAATGG Chr9:60458171..60458190 59.69 45
downstream ENSMUSE00000218363 Chr9:60450386..60450623 AAGCCTTGTAACGCACTGCT Chr9:60450563..60450582 60.08 50
downstream ENSMUSE00000218356 Chr9:60449110..60449295 GTTTCCCTGAGGATCGATTG Chr9:60449172..60449191 59.48 50
downstream ENSMUSE00000218379 Chr9:60445893..60446002 TTGAAATCATGCGGTACTGG Chr9:60445887..60445906 59.54 45
downstream ENSMUSE00000218370 Chr9:60441413..60441566 CAGATGATGCCAGGCTTTTT Chr9:60441488..60441507 60.21 45
downstream ENSMUSE00000427737 Chr9:60435446..60435698 ATCCTTGCTGCGGATCTCTA Chr9:60435518..60435537 59.94 50
downstream ENSMUSE00000533288 Chr9:60435047..60435698 ATCCTTGCTGCGGATCTCTA Chr9:60435518..60435537 59.94 50
downstream ENSMUSE00000697834 Chr9:60435046..60435698 ATCCTTGCTGCGGATCTCTA Chr9:60435518..60435537 59.94 50
downstream ENSMUSE00000378525 Chr9:60416979..60418405 AGTAACATCGGCGGTGTAGG Chr9:60417922..60417941 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:60476279..60476299 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr9:60488282..60488302 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047766