Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30889
Trapped Gene
Cpt1a (ENSMUSG00000024900)
Vector Insertion
Chr 19: 3358278 - 3362084
Public Clones IST13879H11 (tigm) IST13651A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145981 (Chr19:3358176..3358277 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCGAAAGCCCATGTTGTA Chr19:3358197..3358216 60.89 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145981 (Chr19:3358176..3358277 +)
Downstram Exon
ENSMUSE00000145966 (Chr19:3362085..3362222 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCGAAAGCCCATGTTGTA Chr19:3358197..3358216 60.89 50 TGTCATGCGTTGGAAGTCTC Chr19:3362141..3362160 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518400 Chr19:3323348..3323374 No primer for this exon
upstream ENSMUSE00000334115 Chr19:3349189..3349342 GTGGCCTTCCAGTTCACAGT Chr19:3349223..3349242 60.16 55
upstream ENSMUSE00000145992 Chr19:3352485..3352624 TCAATCGGACCCTAGACACC Chr19:3352603..3352622 59.93 55
upstream ENSMUSE00000146005 Chr19:3356317..3356488 CATGTCAAGCCAGACGAAGA Chr19:3356323..3356342 59.98 50
upstream ENSMUSE00000145981 Chr19:3358176..3358277 GGTCGAAAGCCCATGTTGTA Chr19:3358197..3358216 60.89 50

*** Putative Vector Insertion (Chr 19: 3358278 - 3362084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145966 Chr19:3362085..3362222 TGTCATGCGTTGGAAGTCTC Chr19:3362141..3362160 59.84 50
downstream ENSMUSE00000146000 Chr19:3364478..3364555 CCCCGCAGGTAGATGTATTC Chr19:3364518..3364537 59.41 55
downstream ENSMUSE00000145990 Chr19:3365675..3365782 TCTACCGTGCGACGATACAG Chr19:3365766..3365785 59.89 55
downstream ENSMUSE00000145977 Chr19:3366330..3366417 GGATGCGGGAAGTATTGAAG Chr19:3366405..3366424 59.53 50
downstream ENSMUSE00000146003 Chr19:3368855..3369050 CCTTGAAGTAACGGCCTCTG Chr19:3368923..3368942 59.87 55
downstream ENSMUSE00000146012 Chr19:3370707..3370895 TATCCCTGTTCCGATTCGTC Chr19:3370826..3370845 59.89 50
downstream ENSMUSE00000145987 Chr19:3371572..3371677 GGAATGCTCTGCGTTTATGC Chr19:3371644..3371663 60.75 50
downstream ENSMUSE00000145969 Chr19:3375093..3375209 TGTTGGGGTTCTTGTCTCCT Chr19:3375171..3375190 59.55 50
downstream ENSMUSE00000146010 Chr19:3376411..3376575 ACTGGCACTGCTTAGGGATG Chr19:3376452..3376471 60.28 55
downstream ENSMUSE00000237021 Chr19:3378368..3378502 GAAGAGCCGAGTCATGGAAG Chr19:3378421..3378440 59.95 55
downstream ENSMUSE00000145998 Chr19:3380017..3380169 AGGTGAGTCGACTGCCAGAT Chr19:3380160..3380179 59.87 55
downstream ENSMUSE00000146014 Chr19:3381610..3381723 ACAACCTCCATGGCTCAGAC Chr19:3381637..3381656 60.12 55
downstream ENSMUSE00000145968 Chr19:3381932..3382024 GGAAACACCATAGCCGTCAT Chr19:3381961..3381980 59.82 50
downstream ENSMUSE00000344530 Chr19:3383755..3384119 CCATTAGGAGCCGATTCAAA Chr19:3384099..3384118 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGAGATGCCAGTGTCCTT Chr19:3361300..3361320 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATAGGTGGGAGCGTGACTG Chr19:3361317..3361337 58.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024900