Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30898
Trapped Gene
Ddx3y (ENSMUSG00000069045)
Vector Insertion
Chr Y: 603545 - 606284
Public Clones IST14924G5 (tigm) IST11005E8 (tigm) IST11294G7 (tigm) IST13027C5 (tigm)
IST11480F3 (tigm) IST14356H11 (tigm) IST12680C9 (tigm) IST12680C9 (tigm)
IST13584E3 (tigm) IST14356H11 (tigm) IST14869D3 (tigm) IST11318G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568567 (ChrY:606148..606283 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGTCCTACTCCAGTGCAA ChrY:606206..606225 59.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568567 (ChrY:606148..606283 -)
Downstram Exon
ENSMUSE00000568565 (ChrY:603546..603631 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGTCCTACTCCAGTGCAA ChrY:606206..606225 59.03 55 AAGCCTCTCCTGGACCATCT ChrY:603538..603557 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568581 ChrY:622922..623020 GTGGCTGTTCCGTGAGAAGT ChrY:622985..623004 60.31 55
upstream ENSMUSE00000568580 ChrY:620765..620825 No primer for this exon
upstream ENSMUSE00000568579 ChrY:619344..619391 GGGCGCTATATACCTCCTCA ChrY:619370..619389 59.16 55
upstream ENSMUSE00000568575 ChrY:616753..616882 TCAGTGATCGTGGAAGTGGA ChrY:616764..616783 60.25 50
upstream ENSMUSE00000568572 ChrY:615866..616021 GCAAATTTGAACGGAGTGGT ChrY:615940..615959 59.98 45
upstream ENSMUSE00000568571 ChrY:615340..615439 TCTGGAGGAAACACAGGGATT ChrY:615409..615429 60.87 47.62
upstream ENSMUSE00000568567 ChrY:606148..606283 CTCGTCCTACTCCAGTGCAA ChrY:606206..606225 59.03 55
upstream ENSMUSE00000568565 ChrY:603546..603631 GATGGTCCAGGAGAGGCTTT ChrY:603559..603578 60.6 55

*** Putative Vector Insertion (Chr Y: 603545 - 606284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568561 ChrY:603038..603136 TTACGGCGACCATATCTTCC ChrY:603089..603108 59.92 50
downstream ENSMUSE00000568557 ChrY:602802..602962 AAGTCCCGAATCTGCTGAAC ChrY:602867..602886 59.29 50
downstream ENSMUSE00000568554 ChrY:602272..602416 TAGTGTGACGAACCCCCTTT ChrY:602285..602304 59.45 50
downstream ENSMUSE00000568553 ChrY:602018..602162 CTCTGCCTACAGCCAGAAAGA ChrY:602089..602109 59.77 52.38
downstream ENSMUSE00000568552 ChrY:601471..601652 GCGAATCTGCACCCTTTTTA ChrY:601577..601596 60.21 45
downstream ENSMUSE00000568551 ChrY:601284..601401 CAATATCGCTTGGCAAATCA ChrY:601310..601329 59.66 40
downstream ENSMUSE00000568550 ChrY:600239..600392 CCACGGCTACTTCCCTTGTA ChrY:600229..600248 60.12 55
downstream ENSMUSE00000568549 ChrY:600013..600143 GCTCCAAATCCTCCACTGAA ChrY:600098..600117 60.19 50
downstream ENSMUSE00000568548 ChrY:598038..599810 AGCCTGCTGCTGCATAATCT ChrY:598807..598826 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA ChrY:606215..606235 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACTTACGTGACTGGGAAAA ChrY:606219..606241 59.65 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069045