Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30899
Trapped Gene
AC129222.4-202 (ENSMUSG00000058570)
Vector Insertion
Chr 14: 8598728 - 8603817
Public Clones (sanger) (sanger) IST10546B3 (tigm) IST15008G9 (tigm) IST11830F1 (tigm)
IST14356H11 (tigm) IST14508H10 (tigm) IST13486D10 (tigm) IST11626H12 (tigm)
IST14356H11 (tigm) IST14941G6 (tigm) IST13027C5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708370 (Chr14:8603655..8603816 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTATTTTCCGGGAGATTC Chr14:8603748..8603767 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708370 (Chr14:8603655..8603816 -)
Downstram Exon
ENSMUSE00000565306 (Chr14:8598729..8598762 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTATTTTCCGGGAGATTC Chr14:8603748..8603767 59.87 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711789 Chr14:8623922..8624104 CCCAGATACCTCGCTGGATA Chr14:8624033..8624052 60.05 55
upstream ENSMUSE00000306576 Chr14:8622532..8622646 CAACTGCACGCCTCTCATTA Chr14:8622534..8622553 60.01 50
upstream ENSMUSE00000306572 Chr14:8620995..8621168 GGAAACACTGCCCTCCACTA Chr14:8621071..8621090 60.11 55
upstream ENSMUSE00000565309 Chr14:8609025..8609326 GCAGGACATAGACCTGCACA Chr14:8609173..8609192 59.86 55
upstream ENSMUSE00000708370 Chr14:8603655..8603816 GGCTATTTTCCGGGAGATTC Chr14:8603748..8603767 59.87 50
upstream ENSMUSE00000565306 Chr14:8598729..8598762 CCCTGCAAAGAGCACATCTA Chr14:8598743..8598762 59.02 50

*** Putative Vector Insertion (Chr 14: 8598728 - 8603817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000565305 Chr14:8597296..8597368 CACCGTTGATTTGCTTCTTG Chr14:8597325..8597344 59.32 45
downstream ENSMUSE00000650969 Chr14:8589507..8589619 TCTTGCAACTGTGCTTCCTG Chr14:8589575..8589594 60.17 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAAGCAAGCAGAAGGGAGT Chr14:8603817..8603837 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGCAAGCAGAAGGGAGT Chr14:8603817..8603837 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058570