Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30910
Trapped Gene
Srrp (ENSMUSG00000054679)
Vector Insertion
Chr 4: 33313145 - 33317898
Public Clones IST12482F10 (tigm) IST11589H11 (tigm) IST10886H6 (tigm) IST11430D8 (tigm)
IST11640B4 (tigm) IST10928A11 (tigm) IST14869D1 (tigm) IST14522F10 (tigm)
IST11512A4 (tigm) IST13719B10 (tigm) IST11430B3 (tigm) IST13533C5 (tigm)
IST13191F11 (tigm) IST14601E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000430107 (Chr4:33313003..33313144 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCAAAAGAACGCCACCTGT Chr4:33313019..33313038 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000430107 (Chr4:33313003..33313144 +)
Downstram Exon
ENSMUSE00000675799 (Chr4:33317899..33318268 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCAAAAGAACGCCACCTGT Chr4:33313019..33313038 60.16 50 GTACGCTCTGGGAGACTTGC Chr4:33318178..33318197 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000430121 Chr4:33295966..33296345 ATGGGGGATCGGATCTATTC Chr4:33296126..33296145 59.94 50
upstream ENSMUSE00000675802 Chr4:33296238..33296345 GAGGCATGTCTCGCTACACC Chr4:33296276..33296295 60.83 60
upstream ENSMUSE00000675801 Chr4:33310543..33310647 CCCCAGAGGATTTGCTTATG Chr4:33310624..33310643 59.52 50
upstream ENSMUSE00000675800 Chr4:33312740..33312843 CAGTTTGCACAAGGTGATCG Chr4:33312819..33312838 60.3 50
upstream ENSMUSE00000430107 Chr4:33313003..33313144 GTCAAAAGAACGCCACCTGT Chr4:33313019..33313038 60.16 50

*** Putative Vector Insertion (Chr 4: 33313145 - 33317898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000430112 Chr4:33317899..33320315 GTACGCTCTGGGAGACTTGC Chr4:33318178..33318197 60.02 60
downstream ENSMUSE00000675799 Chr4:33317899..33318268 GTACGCTCTGGGAGACTTGC Chr4:33318178..33318197 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCTCATTTTCTGCTGT Chr4:33313169..33313189 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCTCATTTTCTGCTGT Chr4:33313169..33313189 60.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054679