Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30913
Trapped Gene
Gpr82 (ENSMUSG00000047678)
Vector Insertion
Chr X: 13239545 - 13242142
Public Clones IST12628B6 (tigm) IST14212A6 (tigm) IST14998H11 (tigm) IST10198H3 (tigm)
IST14489F12 (tigm) IST10860F1 (tigm) IST13079D2 (tigm) IST14434E2 (tigm)
IST11343C2 (tigm) IST11001B3 (tigm) IST14312C10 (tigm) IST13149F3 (tigm)
IST13149E1 (tigm) IST12551D4 (tigm) IST11360E10 (tigm) IST14312C10 (tigm)
IST10218D11 (tigm) IST10879B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459564 (ChrX:13239454..13239544 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459564 (ChrX:13239454..13239544 +)
Downstram Exon
ENSMUSE00000459558 (ChrX:13242143..13242214 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGTTGTCACAGTGGTCTGCT ChrX:13242210..13242229 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459571 ChrX:13238489..13238569 TCTCCAGCTTCTCAGGATCAA ChrX:13238503..13238523 60.08 47.62
upstream ENSMUSE00000459564 ChrX:13239454..13239544 No primer for this exon

*** Putative Vector Insertion (Chr X: 13239545 - 13242142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459558 ChrX:13242143..13242214 CGTTGTCACAGTGGTCTGCT ChrX:13242210..13242229 59.94 55
downstream ENSMUSE00000331337 ChrX:13242307..13244559 GTGACCGGTAAAGCTGTGGT ChrX:13242405..13242424 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTTAATCGCCTTGCAGCAC ChrX:13239592..13239613 61.65 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACTTCGTGACTGGGAAAACC ChrX:13239590..13239612 60.38 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047678