Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30916
Trapped Gene
Nhsl1 (ENSMUSG00000039835)
Vector Insertion
Chr 10: 18128321 - 18189913
Public Clones (ggtc) IST14741E3 (tigm) IST14733E1 (tigm) IST14619B9 (tigm) IST14106B8 (tigm)
IST12736H12 (tigm) IST12667A10 (tigm) IST11295C2 (tigm) IST10722H12 (tigm)
IST12736H12 (tigm) IST11565G10 (tigm) IST11295C1 (tigm) IST12233H8 (tigm)
IST14930D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644792 (Chr10:18127481..18128320 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCTGGATCTTTTTCTGC Chr10:18127638..18127657 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644792 (Chr10:18127481..18128320 +)
Downstram Exon
ENSMUSE00000577217 (Chr10:18189914..18189971 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCTGGATCTTTTTCTGC Chr10:18127638..18127657 59.96 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644792 Chr10:18127481..18128320 GACGCTGGATCTTTTTCTGC Chr10:18127638..18127657 59.96 50

*** Putative Vector Insertion (Chr 10: 18128321 - 18189913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577217 Chr10:18189914..18189971 No primer for this exon
downstream ENSMUSE00000320434 Chr10:18192725..18192877 TCGACTCTCCTCGTCCAAGT Chr10:18192756..18192775 59.99 55
downstream ENSMUSE00000421066 Chr10:18217839..18217963 TTGCCTCAGCTTGTCACATT Chr10:18217861..18217880 59.44 45
downstream ENSMUSE00000410215 Chr10:18231356..18231548 TGAGGTTGGCGTTTTAGGTC Chr10:18231424..18231443 60.11 50
downstream ENSMUSE00000363998 Chr10:18235835..18235966 CCTGACGATCGAAATTCTCC Chr10:18235858..18235877 59.63 50
downstream ENSMUSE00000710484 Chr10:18243597..18246848 GAGAGGGGCTAACTGCTGTG Chr10:18245909..18245928 60.01 60
downstream ENSMUSE00000713881 Chr10:18243597..18246848 GAGAGGGGCTAACTGCTGTG Chr10:18245909..18245928 60.01 60
downstream ENSMUSE00000320342 Chr10:18247342..18247474 ATACATCCACGGGGTCTGAA Chr10:18247398..18247417 60.19 50
downstream ENSMUSE00000666582 Chr10:18247342..18247474 ATACATCCACGGGGTCTGAA Chr10:18247398..18247417 60.19 50
downstream ENSMUSE00000644788 Chr10:18251074..18253695 CACGATGCCTCTCTTCCTTC Chr10:18252569..18252588 59.95 55
downstream ENSMUSE00000666581 Chr10:18251074..18253695 CACGATGCCTCTCTTCCTTC Chr10:18252569..18252588 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGAATGTTTTTCACCCCCTA Chr10:18161353..18161374 59.3 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGAACGTGACTGGGAAA Chr10:18161365..18161385 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039835