Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30919
Trapped Gene
Herc1 (ENSMUSG00000038664)
Vector Insertion
Chr 9: 66346564 - 66348982
Public Clones IST13645D6 (tigm) IST10855F12 (tigm) IST14818B7 (tigm) IST14517A2 (tigm)
IST10197H4 (tigm) IST14577C5 (tigm) IST12425D11 (tigm) IST11427F2 (tigm)
IST14577D5 (tigm) IST14941B6 (tigm) IST12804G8 (tigm) IST14588G8 (tigm)
IST12804G8 (tigm) IST10315B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532429 (Chr9:66346487..66346563 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532429 (Chr9:66346487..66346563 +)
Downstram Exon
ENSMUSE00000532427 (Chr9:66348983..66349235 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCTGTTTCCACACCAGAGG Chr9:66349120..66349139 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421026 Chr9:66198331..66198428 No primer for this exon
upstream ENSMUSE00000696881 Chr9:66198333..66198428 No primer for this exon
upstream ENSMUSE00000373072 Chr9:66219593..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000709541 Chr9:66219593..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000532422 Chr9:66219619..66220548 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000696870 Chr9:66219619..66220461 AGAAATGGGTGTCCGAACTG Chr9:66220092..66220111 59.97 50
upstream ENSMUSE00000696867 Chr9:66221423..66221443 No primer for this exon
upstream ENSMUSE00000243541 Chr9:66224124..66224219 TCTGCTGATCGGAGTCAGTG Chr9:66224130..66224149 60.14 55
upstream ENSMUSE00000243517 Chr9:66232800..66232994 GGTGATGCTCCCATTGTTTC Chr9:66232860..66232879 60.33 50
upstream ENSMUSE00000243490 Chr9:66234406..66234717 TTGAGCCTCACCGGTCTATT Chr9:66234536..66234555 59.69 50
upstream ENSMUSE00000497296 Chr9:66235968..66236064 GCTGTCACAGAGGATGGTGA Chr9:66236007..66236026 59.83 55
upstream ENSMUSE00000243438 Chr9:66236562..66236705 TGTGGTCTTTTGGAGGAGGT Chr9:66236679..66236698 59.55 50
upstream ENSMUSE00000503199 Chr9:66239167..66239294 GGAGCCAATCTTCACTTGCT Chr9:66239257..66239276 59.43 50
upstream ENSMUSE00000383369 Chr9:66242467..66242611 CTGCTTTGAGACCCAAGCTC Chr9:66242519..66242538 60.13 55
upstream ENSMUSE00000501424 Chr9:66242735..66242906 AGTTTGGCATGGACTGCTCT Chr9:66242875..66242894 59.87 50
upstream ENSMUSE00000420748 Chr9:66244443..66244577 CATGGCACAGGCCTTATTGT Chr9:66244454..66244473 60.91 50
upstream ENSMUSE00000379523 Chr9:66245060..66245225 AGCTGTGCCTGAAGTTGCTT Chr9:66245080..66245099 60.2 50
upstream ENSMUSE00000365226 Chr9:66245645..66245770 CCCAAGGACCTGATAGATGG Chr9:66245730..66245749 59.36 55
upstream ENSMUSE00000420735 Chr9:66247065..66247286 GTGCATGGGATATGGAAACC Chr9:66247169..66247188 60.02 50
upstream ENSMUSE00000243326 Chr9:66247575..66247727 GATCAAGCATTTGGAGAGCTG Chr9:66247575..66247595 59.97 47.62
upstream ENSMUSE00000243302 Chr9:66247854..66247986 AGTCCTTGGAATGGCAGTGT Chr9:66247950..66247969 59.58 50
upstream ENSMUSE00000243280 Chr9:66250331..66250522 GTGTCAGTGGCTCGTCCTTT Chr9:66250399..66250418 60.31 55
upstream ENSMUSE00000384286 Chr9:66255791..66256012 AAATGGACACCCCTCAGTTG Chr9:66255992..66256011 59.82 50
upstream ENSMUSE00000420717 Chr9:66258823..66258996 AGACTTGGCATTGGGTTGTT Chr9:66258920..66258939 59.45 45
upstream ENSMUSE00000584160 Chr9:66258823..66258863 No primer for this exon
upstream ENSMUSE00000532489 Chr9:66261882..66261996 TTGCAGCACTCCTCAAACAC Chr9:66261942..66261961 60.03 50
upstream ENSMUSE00000635977 Chr9:66261882..66262000 TTGCAGCACTCCTCAAACAC Chr9:66261942..66261961 60.03 50
upstream ENSMUSE00000532488 Chr9:66262086..66262206 CTTGCTTGCAAGAACCTTGA Chr9:66262150..66262169 59.19 45
upstream ENSMUSE00000635976 Chr9:66262093..66262206 CTTGCTTGCAAGAACCTTGA Chr9:66262150..66262169 59.19 45
upstream ENSMUSE00000532487 Chr9:66263991..66264162 AAGAAGAGCGGGAACATGAA Chr9:66264127..66264146 59.81 45
upstream ENSMUSE00000532485 Chr9:66266203..66266515 CGTAGCCGAGACCGAGATAG Chr9:66266241..66266260 59.99 60
upstream ENSMUSE00000532484 Chr9:66266936..66267056 CTGAGAGCCGCCTAGTTCAT Chr9:66266953..66266972 59.6 55
upstream ENSMUSE00000532483 Chr9:66268804..66268855 CCGACGAAATGTTGACTTTGA Chr9:66268809..66268829 61.04 42.86
upstream ENSMUSE00000532482 Chr9:66276618..66276886 CTCTTGGACTCGCCTGAAAC Chr9:66276652..66276671 59.99 55
upstream ENSMUSE00000532481 Chr9:66281083..66281298 CGGGAACCAAAGGAGAGAGT Chr9:66281258..66281277 60.62 55
upstream ENSMUSE00000532480 Chr9:66281531..66281651 GAGAGAGCCCTTCAAGCAAA Chr9:66281618..66281637 59.69 50
upstream ENSMUSE00000532479 Chr9:66281873..66282110 GTGGCCAGTACAAGGTTGCT Chr9:66282067..66282086 60.18 55
upstream ENSMUSE00000532477 Chr9:66282218..66282405 TTGTCTCAAACTGGTGTGCTG Chr9:66282294..66282314 59.93 47.62
upstream ENSMUSE00000532476 Chr9:66285402..66285557 ACAACATGCAGCTGAACTCC Chr9:66285415..66285434 58.88 50
upstream ENSMUSE00000532475 Chr9:66286985..66287091 CGAGGCTTCTTGCTCTTCAC Chr9:66287012..66287031 60.28 55
upstream ENSMUSE00000635970 Chr9:66287603..66287713 TTTTCCCTTCTGTCGGATTG Chr9:66287618..66287637 60.04 45
upstream ENSMUSE00000532469 Chr9:66289710..66289886 AACTCATGGCAGTGGAGGAA Chr9:66289814..66289833 60.66 50
upstream ENSMUSE00000420699 Chr9:66293260..66293499 TCACCGCACTACCTCAGACA Chr9:66293337..66293356 60.46 55
upstream ENSMUSE00000420693 Chr9:66293892..66293975 GAAGATGTGGATGCAGCAGA Chr9:66293910..66293929 59.95 50
upstream ENSMUSE00000361061 Chr9:66295819..66296339 TATCCTTCACCGGACAGACC Chr9:66295932..66295951 59.93 55
upstream ENSMUSE00000219238 Chr9:66298510..66299285 GAGCATCAAGCGACATGAAA Chr9:66298666..66298685 59.96 45
upstream ENSMUSE00000343738 Chr9:66301144..66301342 GAAAGTGACCAAGCACAGCA Chr9:66301164..66301183 60.03 50
upstream ENSMUSE00000242882 Chr9:66303743..66303903 CCAGCCTCTCCTTCTGATGA Chr9:66303819..66303838 60.49 55
upstream ENSMUSE00000242856 Chr9:66305244..66305360 ACTTTCAACGTCCCCTCCTC Chr9:66305266..66305285 60.49 55
upstream ENSMUSE00000242842 Chr9:66306001..66306232 CGACAGTTCTGGGAAGTGGT Chr9:66306124..66306143 60.15 55
upstream ENSMUSE00000242826 Chr9:66308215..66308339 CTGGAAGTGGACCACCAACT Chr9:66308250..66308269 60 55
upstream ENSMUSE00000332324 Chr9:66309507..66309727 CAGGGGCGTTGTATGACTTT Chr9:66309579..66309598 59.99 50
upstream ENSMUSE00000381364 Chr9:66310636..66310904 GGGAAGAAGTGGTCGTGTGT Chr9:66310658..66310677 60.01 55
upstream ENSMUSE00000332837 Chr9:66312513..66312565 CCCAGATCTAATTGGCAAGC Chr9:66312528..66312547 59.67 50
upstream ENSMUSE00000242738 Chr9:66313188..66313388 TGGGAGCATCAGTAGCAATG Chr9:66313326..66313345 59.82 50
upstream ENSMUSE00000242716 Chr9:66314306..66314480 CATGCGAGCACTGTCTCTTC Chr9:66314451..66314470 59.73 55
upstream ENSMUSE00000242696 Chr9:66315190..66315460 CTCAGAACGTTCACGAGGTG Chr9:66315325..66315344 59.46 55
upstream ENSMUSE00000242676 Chr9:66315567..66315780 CAAGCCCTTGTGGCATTATT Chr9:66315702..66315721 59.96 45
upstream ENSMUSE00000412190 Chr9:66316785..66316990 CAACAACTTGTGCGCACTCT Chr9:66316865..66316884 60.1 50
upstream ENSMUSE00000342407 Chr9:66318045..66318172 GCACTATTCGGGTGTGGAAT Chr9:66318103..66318122 59.82 50
upstream ENSMUSE00000635962 Chr9:66319653..66319780 CAGTGGCAAATACCTTGCTG Chr9:66319722..66319741 59.34 50
upstream ENSMUSE00000635961 Chr9:66321190..66321390 GACGGATGGACGGATCTCTA Chr9:66321301..66321320 60.03 55
upstream ENSMUSE00000635960 Chr9:66322541..66322671 CTGCATTGCTTGGTTCAGTG Chr9:66322551..66322570 60.45 50
upstream ENSMUSE00000635958 Chr9:66323728..66323927 TGCCATCCATCCACTGTAAA Chr9:66323848..66323867 59.92 45
upstream ENSMUSE00000635957 Chr9:66324135..66324240 TGTGTTTGGCGTATTCCTCA Chr9:66324157..66324176 60.11 45
upstream ENSMUSE00000635956 Chr9:66326752..66326898 GGACACATCACACCTGTTCG Chr9:66326800..66326819 60.01 55
upstream ENSMUSE00000635955 Chr9:66327238..66327339 ATCGGCTCTGGAGCTATTCA Chr9:66327265..66327284 59.94 50
upstream ENSMUSE00000635954 Chr9:66328669..66328842 CCATGATGCTTCAAGAGCAA Chr9:66328808..66328827 59.95 45
upstream ENSMUSE00000532443 Chr9:66329611..66329904 AGCGCAGTTTCCAGAGTCAT Chr9:66329832..66329851 60.02 50
upstream ENSMUSE00000532442 Chr9:66331464..66331529 GTCTTGGGCAACTTCCAGAC Chr9:66331505..66331524 59.7 55
upstream ENSMUSE00000532441 Chr9:66331685..66331810 GTACCAGCTACAGCGCCTTC Chr9:66331772..66331791 60.04 60
upstream ENSMUSE00000532440 Chr9:66332706..66332844 TATGGCAGATTAGGGCAAGG Chr9:66332778..66332797 60.05 50
upstream ENSMUSE00000532439 Chr9:66333874..66334055 GAGATGGGGACTATGGCAAA Chr9:66333961..66333980 59.89 50
upstream ENSMUSE00000532438 Chr9:66334731..66334886 TTACCTTTGGGAACGGTGAC Chr9:66334783..66334802 59.83 50
upstream ENSMUSE00000532437 Chr9:66335756..66335878 GCCTAGGAAATTCCACAGCA Chr9:66335844..66335863 60.21 50
upstream ENSMUSE00000532436 Chr9:66337137..66337239 TGTCCTCTGTGGAATTGGAA Chr9:66337145..66337164 59.06 45
upstream ENSMUSE00000532435 Chr9:66339765..66339934 GTTTATGCCTGGGGTAGCAA Chr9:66339902..66339921 59.96 50
upstream ENSMUSE00000532434 Chr9:66340963..66341101 AACCACGTTCGAGAACCAAC Chr9:66340981..66341000 60.01 50
upstream ENSMUSE00000532433 Chr9:66343707..66343876 TCATCATGGAGGTTGCTGAA Chr9:66343838..66343857 60.2 45
upstream ENSMUSE00000532432 Chr9:66344976..66345145 CAACTTCGGCCTCTGTTAGC Chr9:66345024..66345043 60.01 55
upstream ENSMUSE00000532430 Chr9:66345396..66345561 TGGAAGGTTAAGCTGGTTGG Chr9:66345484..66345503 60.1 50
upstream ENSMUSE00000532429 Chr9:66346487..66346563 No primer for this exon

*** Putative Vector Insertion (Chr 9: 66346564 - 66348982) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532427 Chr9:66348983..66349235 AGCTGTTTCCACACCAGAGG Chr9:66349120..66349139 60.3 55
downstream ENSMUSE00000242257 Chr9:66349737..66349889 CTCTGGCCGACAAAAGAATC Chr9:66349771..66349790 59.81 50
downstream ENSMUSE00000532426 Chr9:66352395..66352700 GACATCCCTTCTCGAACTGC Chr9:66352423..66352442 59.81 55
downstream ENSMUSE00000696877 Chr9:66355946..66356582 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45
downstream ENSMUSE00000696882 Chr9:66355946..66356575 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000038664