Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30921
Trapped Gene
Zmat3 (ENSMUSG00000027663)
Vector Insertion
Chr 3: 32242473 - 32244503
Public Clones (sanger) IST12175F6 (tigm) IST14333H12 (tigm) IST12155H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171896 (Chr3:32244380..32244502 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATGGCAAGAAACTACGAAA Chr3:32244474..32244494 60.12 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171896 (Chr3:32244380..32244502 -)
Downstram Exon
ENSMUSE00000171893 (Chr3:32242474..32242640 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATGGCAAGAAACTACGAAA Chr3:32244474..32244494 60.12 42.86 GGAGTCTCTTGGCATGGTTC Chr3:32242483..32242502 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676063 Chr3:32264426..32264587 CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45
upstream ENSMUSE00000273004 Chr3:32259812..32260138 ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50
upstream ENSMUSE00000171896 Chr3:32244380..32244502 CCATGGCAAGAAACTACGAAA Chr3:32244474..32244494 60.12 42.86
upstream ENSMUSE00000171893 Chr3:32242474..32242640 GGGTGATCCTGGCTACAGAG Chr3:32242596..32242615 59.68 60

*** Putative Vector Insertion (Chr 3: 32242473 - 32244503) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171898 Chr3:32242256..32242356 ACTCCCTTCTTTCCGAGTCC Chr3:32242289..32242308 59.68 55
downstream ENSMUSE00000592911 Chr3:32233714..32240617 CGCCTACACGTCCCTAACAT Chr3:32238201..32238220 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGTAAAAACCATGGCAAG Chr3:32244483..32244503 58.95 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGTAAAAACCATGGCAAG Chr3:32244483..32244503 58.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027663