Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30928
Trapped Gene
AI118078 (ENSMUSG00000032313)
Vector Insertion
Chr 9: 55278272 - 55282997
Public Clones IST14891H10 (tigm) IST14754H2 (tigm) IST14918H2 (tigm) IST14877H8 (tigm)
IST14754H2 (tigm) IST14894H3 (tigm) IST14916H8 (tigm) IST14912H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000265467 (Chr9:55278082..55278271 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCATCGTGGAAGAGCTG Chr9:55278239..55278258 60.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000265467 (Chr9:55278082..55278271 +)
Downstram Exon
ENSMUSE00000265449 (Chr9:55282998..55283060 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCATCGTGGAAGAGCTG Chr9:55278239..55278258 60.7 55 TGCTGGGCCCATTGTAGTAT Chr9:55283060..55283079 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698845 Chr9:55174720..55174807 AGAGCAGAGCGAATCCTGAG Chr9:55174776..55174795 59.85 55
upstream ENSMUSE00000356736 Chr9:55174756..55174807 AGAGCAGAGCGAATCCTGAG Chr9:55174776..55174795 59.85 55
upstream ENSMUSE00000712600 Chr9:55225287..55225420 GCTGAGCCCCACTAGACATC Chr9:55225353..55225372 59.83 60
upstream ENSMUSE00000714771 Chr9:55225287..55225420 GCTGAGCCCCACTAGACATC Chr9:55225353..55225372 59.83 60
upstream ENSMUSE00000414646 Chr9:55228486..55228674 AACTTTGCCTATCGGGACCT Chr9:55228577..55228596 59.96 50
upstream ENSMUSE00000698840 Chr9:55228486..55228674 AACTTTGCCTATCGGGACCT Chr9:55228577..55228596 59.96 50
upstream ENSMUSE00000534523 Chr9:55244311..55244430 TCACCATCACCACCATCATC Chr9:55244361..55244380 60.19 50
upstream ENSMUSE00000363822 Chr9:55245548..55245702 CAGCCGTATGGCAGGTATTT Chr9:55245583..55245602 59.98 50
upstream ENSMUSE00000405019 Chr9:55248381..55248454 GCTTTCCAGTTTGCTGGTGT Chr9:55248389..55248408 60.3 50
upstream ENSMUSE00000364639 Chr9:55261671..55261727 CCTACGGATCGTGGTACTGG Chr9:55261676..55261695 60.39 60
upstream ENSMUSE00000408236 Chr9:55262747..55262885 TCATCATGTTCCGAATCTGG Chr9:55262844..55262863 59.45 45
upstream ENSMUSE00000265482 Chr9:55265815..55265930 TGACGCAAATCTGTCAGGAG Chr9:55265905..55265924 59.98 50
upstream ENSMUSE00000265467 Chr9:55278082..55278271 AGAGCATCGTGGAAGAGCTG Chr9:55278239..55278258 60.7 55

*** Putative Vector Insertion (Chr 9: 55278272 - 55282997) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000265449 Chr9:55282998..55283060 TGCTGGGCCCATTGTAGTAT Chr9:55283060..55283079 60.35 50
downstream ENSMUSE00000534522 Chr9:55282998..55286149 GAACGAAGGCAACGAAAGAG Chr9:55285881..55285900 59.99 50
downstream ENSMUSE00000340305 Chr9:55284914..55286151 GAACGAAGGCAACGAAAGAG Chr9:55285881..55285900 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCACTCCTAATCGCCTTG Chr9:55281314..55281334 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCCCCAAGGATTCCTAC Chr9:55281290..55281310 59.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032313