Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30930
Trapped Gene
Dennd2c (ENSMUSG00000007379)
Vector Insertion
Chr 3: 102945079 - 102950434
Public Clones IST14261F9 (tigm) IST12613E12 (tigm) IST12585F1 (tigm) IST12754A9 (tigm)
IST12807B2 (tigm) IST12613E12 (tigm) IST10471D3 (tigm) IST10186D2 (tigm)
IST10398B3 (tigm) IST12585F1 (tigm) IST13848D12 (tigm) IST10097B1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436887 (Chr3:102944982..102945078 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436887 (Chr3:102944982..102945078 +)
Downstram Exon
ENSMUSE00000317738 (Chr3:102950435..102950479 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000476993 Chr3:102931479..102931573 No primer for this exon
upstream ENSMUSE00000503383 Chr3:102935276..102936254 No primer for this exon
upstream ENSMUSE00000479269 Chr3:102937138..102937268 No primer for this exon
upstream ENSMUSE00000480665 Chr3:102937662..102937774 No primer for this exon
upstream ENSMUSE00000317751 Chr3:102941066..102941236 No primer for this exon
upstream ENSMUSE00000436887 Chr3:102944982..102945078 No primer for this exon

*** Putative Vector Insertion (Chr 3: 102945079 - 102950434) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317738 Chr3:102950435..102950479 No primer for this exon
downstream ENSMUSE00000317731 Chr3:102952964..102953145 No primer for this exon
downstream ENSMUSE00000173618 Chr3:102956216..102956325 No primer for this exon
downstream ENSMUSE00000173616 Chr3:102957560..102957629 No primer for this exon
downstream ENSMUSE00000173615 Chr3:102958411..102958488 No primer for this exon
downstream ENSMUSE00000565800 Chr3:102959963..102960103 No primer for this exon
downstream ENSMUSE00000173619 Chr3:102960725..102960873 No primer for this exon
downstream ENSMUSE00000173620 Chr3:102961567..102961744 No primer for this exon
downstream ENSMUSE00000173614 Chr3:102965471..102965512 No primer for this exon
downstream ENSMUSE00000173612 Chr3:102966914..102967019 No primer for this exon
downstream ENSMUSE00000317680 Chr3:102968931..102969167 No primer for this exon
downstream ENSMUSE00000412036 Chr3:102970336..102970422 No primer for this exon
downstream ENSMUSE00000565798 Chr3:102971694..102973654 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCTCCTCAAAAGGTAAGC Chr3:102945066..102945086 60.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTAGCCGTGACTGGGAAAA Chr3:102945124..102945144 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007379