Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30940
Trapped Gene
Capn5 (ENSMUSG00000035547)
Vector Insertion
Chr 7: 105310785 - 105326762
Public Clones IST13303H5 (tigm) IST13303H6 (tigm) IST12869B9 (tigm) IST13202H10 (tigm)
IST14587E7 (tigm) IST15075G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000514708 (Chr7:105326554..105326761 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATCATCTCCCCGCAGAGTC Chr7:105326649..105326668 60.18 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000514708 (Chr7:105326554..105326761 -)
Downstram Exon
ENSMUSE00000672158 (Chr7:105310786..105310852 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATCATCTCCCCGCAGAGTC Chr7:105326649..105326668 60.18 55 GAGGACACGGAGTGAAGCAC Chr7:105310779..105310798 60.87 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514708 Chr7:105326554..105326761 TATCATCTCCCCGCAGAGTC Chr7:105326649..105326668 60.18 55
upstream ENSMUSE00000672158 Chr7:105310786..105310852 GTGCTTCACTCCGTGTCCTC Chr7:105310801..105310820 60.87 60

*** Putative Vector Insertion (Chr 7: 105310785 - 105326762) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000458972 Chr7:105310426..105310620 CTTCAGCGCCGAGTAGTTCT Chr7:105310518..105310537 59.78 55
downstream ENSMUSE00000716773 Chr7:105310426..105310620 CTTCAGCGCCGAGTAGTTCT Chr7:105310518..105310537 59.78 55
downstream ENSMUSE00000497631 Chr7:105300322..105300453 CTGATGCCATCTACGAAGAGC Chr7:105300391..105300411 59.99 52.38
downstream ENSMUSE00000268550 Chr7:105284270..105284478 GACGATTACGTCCACCCACT Chr7:105284346..105284365 59.85 55
downstream ENSMUSE00000268542 Chr7:105281343..105281535 CCTCTTAGCCTCGTCAGTGG Chr7:105281387..105281406 60.01 60
downstream ENSMUSE00000268535 Chr7:105280186..105280379 GGGTTCCTCAGACGGATCAT Chr7:105280203..105280222 61.26 55
downstream ENSMUSE00000268529 Chr7:105279701..105279778 GCTCACTTTCTGCCATTCCT Chr7:105279732..105279751 59.43 50
downstream ENSMUSE00000268524 Chr7:105277754..105277949 GTGTTAATCAGGCGGCATTT Chr7:105277865..105277884 59.97 45
downstream ENSMUSE00000268515 Chr7:105276983..105277105 CGCTGCTGGATACTGATCAAC Chr7:105277028..105277048 60.81 52.38
downstream ENSMUSE00000268508 Chr7:105274756..105274952 CATACGGTATTGGCGGTTCT Chr7:105274904..105274923 59.85 50
downstream ENSMUSE00000268502 Chr7:105274339..105274454 AGGGTAGCCACAGAGGGAAC Chr7:105274375..105274394 60.51 60
downstream ENSMUSE00000268497 Chr7:105273752..105273888 GAGCCAGCTTCTTGCGATAG Chr7:105273747..105273766 60.26 55
downstream ENSMUSE00000672157 Chr7:105272171..105272565 GGTCACACAGTGGGTCAGTG Chr7:105272233..105272252 60.04 60
downstream ENSMUSE00000469208 Chr7:105270076..105272565 GCAGACGCTCAACAAAATGA Chr7:105271167..105271186 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGCCGATTCTTGAGCTT Chr7:105317760..105317780 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGAACGTGACTGGGAAAA Chr7:105317697..105317718 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035547