Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30946
Trapped Gene
Dlg1 (ENSMUSG00000022770)
Vector Insertion
Chr 16: 31812911 - 31829551
Public Clones (sanger) IST11565B3 (tigm) IST13580E8 (tigm) IST13742C11 (tigm) IST10699A11 (tigm)
IST15083G7 (tigm) IST14566H2 (tigm) IST10708C1 (tigm) IST11565B3 (tigm)
IST11028G6 (tigm) IST13004B7 (tigm) IST13742C11 (tigm) IST13979E2 (tigm)
IST14617G12 (tigm) IST12592E7 (tigm) IST12433D3 (tigm) IST14137B10 (tigm)
IST12990B10 (tigm) IST15089D5 (tigm) IST13979E2 (tigm) IST10699A11 (tigm)
IST13580E8 (tigm) IST14149E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230817 (Chr16:31812754..31812910 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTCATCGTGGCTCAACAG Chr16:31812772..31812791 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230817 (Chr16:31812754..31812910 +)
Downstram Exon
ENSMUSE00000230810 (Chr16:31829552..31829654 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTCATCGTGGCTCAACAG Chr16:31812772..31812791 59.98 50 TGTTCGTGACTTGCAGCTCT Chr16:31829592..31829611 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434992 Chr16:31663529..31663574 GTGAGGGGTGTCTTGAGCTT Chr16:31663534..31663553 59.31 55
upstream ENSMUSE00000644422 Chr16:31663995..31664407 No primer for this exon
upstream ENSMUSE00000434707 Chr16:31664125..31664407 No primer for this exon
upstream ENSMUSE00000702035 Chr16:31664236..31664407 No primer for this exon
upstream ENSMUSE00000334814 Chr16:31664907..31664956 No primer for this exon
upstream ENSMUSE00000709094 Chr16:31664907..31664956 No primer for this exon
upstream ENSMUSE00000375424 Chr16:31665661..31665792 AGAGCATTGCATCTGTTGGA Chr16:31665669..31665688 59.4 45
upstream ENSMUSE00000230857 Chr16:31684214..31684380 GTGAACCAGTTCAGCCTGTG Chr16:31684280..31684299 59.31 55
upstream ENSMUSE00000130290 Chr16:31743192..31743356 CCGGTATCAGGATGAAGAGGT Chr16:31743197..31743217 60.33 52.38
upstream ENSMUSE00000702027 Chr16:31754436..31755102 AAGGGTCTTGGTAGCCCAGT Chr16:31754461..31754480 59.99 55
upstream ENSMUSE00000130294 Chr16:31771843..31771941 GCCAGTCCCTGCTGAGAGTA Chr16:31771896..31771915 60.56 60
upstream ENSMUSE00000702029 Chr16:31771843..31772010 GCCAGTCCCTGCTGAGAGTA Chr16:31771896..31771915 60.56 60
upstream ENSMUSE00000130301 Chr16:31781868..31781921 TGCTGGTCAACACAGACAGC Chr16:31781884..31781903 61.1 55
upstream ENSMUSE00000130286 Chr16:31788168..31788218 TGGCACTGATGCAGATTATGA Chr16:31788173..31788193 60.24 42.86
upstream ENSMUSE00000130284 Chr16:31790263..31790387 GGAAATTCGGGTCTTGGTTT Chr16:31790263..31790282 60.17 45
upstream ENSMUSE00000130288 Chr16:31791801..31791970 GTATGTGAAAAGGCGGAAGC Chr16:31791903..31791922 59.71 50
upstream ENSMUSE00000130298 Chr16:31793590..31793726 GGCAAGCTTCAGATTGGAGA Chr16:31793694..31793713 60.48 50
upstream ENSMUSE00000130296 Chr16:31796952..31797096 GCTATGCACCACCTGACATC Chr16:31797070..31797089 59.12 55
upstream ENSMUSE00000130283 Chr16:31805700..31805820 GTGCTCGGAGATGACGAGAT Chr16:31805795..31805814 60.38 55
upstream ENSMUSE00000230817 Chr16:31812754..31812910 TCTTCATCGTGGCTCAACAG Chr16:31812772..31812791 59.98 50

*** Putative Vector Insertion (Chr 16: 31812911 - 31829551) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230810 Chr16:31829552..31829654 TGTTCGTGACTTGCAGCTCT Chr16:31829592..31829611 59.78 50
downstream ENSMUSE00000230805 Chr16:31836276..31836390 TGGTTCGAAGAGACCCTGAC Chr16:31836368..31836387 60.24 55
downstream ENSMUSE00000230798 Chr16:31838136..31838312 CTCCGACTTCGTCACTCTCC Chr16:31838296..31838315 59.99 60
downstream ENSMUSE00000230790 Chr16:31842856..31842925 TTTTAATCGGGCTCGTTCCT Chr16:31842889..31842908 60.92 45
downstream ENSMUSE00000511839 Chr16:31846920..31847019 CAGCATCACTCGTTTCCTGT Chr16:31847019..31847038 58.88 50
downstream ENSMUSE00000702050 Chr16:31846923..31847019 TCAGCATCACTCGTTTCCTG Chr16:31847020..31847039 59.98 50
downstream ENSMUSE00000434693 Chr16:31847722..31847755 CCTTTTGATCCCATGTCGTC Chr16:31847753..31847772 60.32 50
downstream ENSMUSE00000230778 Chr16:31853929..31853970 CGCTGGCATTAGAAGTTACG Chr16:31853955..31853974 58.61 50
downstream ENSMUSE00000702026 Chr16:31854739..31854774 CTTTTGAGCAGCCATATTCATC Chr16:31854775..31854796 58.86 40.91
downstream ENSMUSE00000702039 Chr16:31854754..31854774 No primer for this exon
downstream ENSMUSE00000230770 Chr16:31856527..31856577 No primer for this exon
downstream ENSMUSE00000521165 Chr16:31857633..31857734 CAGGATCCAAATTTGTCAGGA Chr16:31857728..31857748 59.92 42.86
downstream ENSMUSE00000559866 Chr16:31857978..31858150 GCTCGTCCCATACAGATGGT Chr16:31858123..31858142 59.96 55
downstream ENSMUSE00000230750 Chr16:31863259..31863368 TGTGCAATCTGCAACCTCTT Chr16:31863320..31863339 59.44 45
downstream ENSMUSE00000230745 Chr16:31867917..31868008 TGTTTTTCTGGCCTGCTCTT Chr16:31867962..31867981 59.99 45
downstream ENSMUSE00000434713 Chr16:31871761..31872347 CTGGTCAGGCCATTCATCTT Chr16:31872090..31872109 60.07 50
downstream ENSMUSE00000702033 Chr16:31871761..31872770 GGGAGGGCACACAATAAAGA Chr16:31872459..31872478 59.93 50
downstream ENSMUSE00000702038 Chr16:31871761..31871932 AAATGTCCTCCAGCGTGTCT Chr16:31871796..31871815 59.73 50
downstream ENSMUSE00000702048 Chr16:31871761..31873436 TGCCAAAATCACGTATCGAA Chr16:31873339..31873358 60.07 40
downstream ENSMUSE00000702054 Chr16:31871761..31873428 TGCCAAAATCACGTATCGAA Chr16:31873339..31873358 60.07 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCCCCTTCCATGTTGTTG Chr16:31821876..31821896 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGCATCATATCGGTAGGTC Chr16:31821899..31821919 58.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022770