Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30952
Trapped Gene
1700030K09Rik (ENSMUSG00000052794)
Vector Insertion
Chr 8: 74967889 - 74968648
Public Clones IST12325H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326529 (Chr8:74967825..74967888 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCCAACGCAGCTACTCAG Chr8:74967869..74967888 60.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326529 (Chr8:74967825..74967888 +)
Downstram Exon
ENSMUSE00000710182 (Chr8:74968649..74969369 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCCAACGCAGCTACTCAG Chr8:74967869..74967888 60.73 55 ATTTCTCGTCCATCGTTTGG Chr8:74968827..74968846 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326529 Chr8:74967825..74967888 AAGCCAACGCAGCTACTCAG Chr8:74967869..74967888 60.73 55
upstream ENSMUSE00000716120 Chr8:74967831..74967888 AAGCCAACGCAGCTACTCAG Chr8:74967869..74967888 60.73 55

*** Putative Vector Insertion (Chr 8: 74967889 - 74968648) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456301 Chr8:74968649..74969369 ATTTCTCGTCCATCGTTTGG Chr8:74968827..74968846 59.93 45
downstream ENSMUSE00000710182 Chr8:74968649..74969369 ATTTCTCGTCCATCGTTTGG Chr8:74968827..74968846 59.93 45
downstream ENSMUSE00000456279 Chr8:74973349..74973640 GCTTGATGCATCCCATCTTT Chr8:74973565..74973584 60.04 45
downstream ENSMUSE00000456058 Chr8:74975258..74975331 TGGTCCCCATCTGATTTGTC Chr8:74975330..74975349 60.72 50
downstream ENSMUSE00000456054 Chr8:74979013..74979466 GTCCTGTCAAGCGACTCCTC Chr8:74979311..74979330 59.99 60
downstream ENSMUSE00000715385 Chr8:74979115..74979466 GTCCTGTCAAGCGACTCCTC Chr8:74979311..74979330 59.99 60
downstream ENSMUSE00000456048 Chr8:74981872..74981967 GTCTGCGCTGACAATGTGAC Chr8:74981960..74981979 60.48 55
downstream ENSMUSE00000456043 Chr8:74982502..74982668 CATGTCATTCAACGCCAGAA Chr8:74982548..74982567 60.67 45
downstream ENSMUSE00000456290 Chr8:74983928..74984439 GCAGATGGGAGCGTAGAGTC Chr8:74984131..74984150 59.98 60
downstream ENSMUSE00000719590 Chr8:74983928..74984540 GCAGATGGGAGCGTAGAGTC Chr8:74984131..74984150 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGCCAACGCAGCTACTC Chr8:74967868..74967888 59.79 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACAGTGATCAAGTGGGTTG Chr8:74967896..74967917 59.58 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052794