Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30970
Trapped Gene
AC157601.7-201 (ENSMUSG00000072742)
Vector Insertion
Chr 14: 5746923 - 6374670
Public Clones IST12681D7 (tigm) IST14643F8 (tigm) IST14270F5 (tigm) IST14463F6 (tigm)
IST12800B3 (tigm) IST12413G7 (tigm) IST13353A6 (tigm) IST14130H8 (tigm)
IST12681D7 (tigm) IST12275C4 (tigm) IST10280G5 (tigm) IST12727C11 (tigm)
IST13833D7 (tigm) IST14837F3 (tigm) IST12275C4 (tigm) IST13474A3 (tigm)
IST12909G9 (tigm) IST12018E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000617752 (Chr14:5746793..5746922 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000617752 (Chr14:5746793..5746922 +)
Downstram Exon
ENSMUSE00000620686 (Chr14:6374671..6374833 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000617752 Chr14:5746793..5746922 No primer for this exon

*** Putative Vector Insertion (Chr 14: 5746923 - 6374670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000620686 Chr14:6374671..6374833 No primer for this exon
downstream ENSMUSE00000693039 Chr14:6453708..6453839 No primer for this exon
downstream ENSMUSE00000693037 Chr14:6454516..6454696 No primer for this exon
downstream ENSMUSE00000693042 Chr14:6806325..6806456 No primer for this exon
downstream ENSMUSE00000693041 Chr14:6807133..6807313 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAATTAATCGCCTTGCAG Chr14:6265968..6265988 58.44 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr14:6004970..6004990 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072742