Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30978
Trapped Gene
Fyb (ENSMUSG00000022148)
Vector Insertion
Chr 15: 6531047 - 6569593
Public Clones IST13688E1 (tigm) IST12001F8 (tigm) IST12001A12 (tigm) IST12093G9 (tigm)
IST14742F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361836 (Chr15:6529871..6531046 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAAATCCCTCATGGCGAAG Chr15:6529937..6529956 60.03 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361836 (Chr15:6529871..6531046 +)
Downstram Exon
ENSMUSE00000123958 (Chr15:6569594..6569750 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAAATCCCTCATGGCGAAG Chr15:6529937..6529956 60.03 45 GGCAGGGAAGTTGTCGAGTA Chr15:6569639..6569658 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361836 Chr15:6529871..6531046 TAAAATCCCTCATGGCGAAG Chr15:6529937..6529956 60.03 45

*** Putative Vector Insertion (Chr 15: 6531047 - 6569593) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000123958 Chr15:6569594..6569750 GGCAGGGAAGTTGTCGAGTA Chr15:6569639..6569658 60.26 55
downstream ENSMUSE00000123957 Chr15:6580072..6580118 GAGTGCATGACACCATCTTGA Chr15:6580115..6580135 59.7 47.62
downstream ENSMUSE00000684845 Chr15:6582265..6582284 No primer for this exon
downstream ENSMUSE00000123959 Chr15:6582777..6582811 TCTTCGTATGTTTCCCCTTCA Chr15:6582810..6582830 59.56 42.86
downstream ENSMUSE00000273842 Chr15:6584796..6584916 TTCCCGTTTCTTGTCTCGTT Chr15:6584832..6584851 59.71 45
downstream ENSMUSE00000564240 Chr15:6588807..6588966 GGTTGTCTGTGATGCGGATA Chr15:6588930..6588949 59.53 50
downstream ENSMUSE00000273832 Chr15:6590441..6590585 CTTCCGTTTCAGCGAATCAT Chr15:6590499..6590518 60.21 45
downstream ENSMUSE00000485515 Chr15:6592557..6592579 No primer for this exon
downstream ENSMUSE00000273822 Chr15:6593694..6593763 GATCTCGTCGTCTGTTGGTG Chr15:6593731..6593750 59.26 55
downstream ENSMUSE00000273817 Chr15:6594762..6594899 CCAGGACCATGCGTTAGTCT Chr15:6594807..6594826 60.13 55
downstream ENSMUSE00000480119 Chr15:6596637..6596662 No primer for this exon
downstream ENSMUSE00000273806 Chr15:6598854..6598920 GAGGCATCCACATCATCGTA Chr15:6598893..6598912 59.48 50
downstream ENSMUSE00000273801 Chr15:6601804..6601903 TTGCCCTTCCAACACTCATT Chr15:6601832..6601851 60.49 45
downstream ENSMUSE00000273797 Chr15:6602382..6602544 AACTCGAATTTCACCGTCGT Chr15:6602405..6602424 59.6 45
downstream ENSMUSE00000273794 Chr15:6608532..6608565 CACCAGGTAACTCCGAAGGA Chr15:6608563..6608582 60.1 55
downstream ENSMUSE00000273791 Chr15:6610683..6610714 No primer for this exon
downstream ENSMUSE00000564236 Chr15:6613150..6613321 TGGCCACTAAGAGGCACAGT Chr15:6613215..6613234 60.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTAGAGACACAAGCCCCATA Chr15:6561050..6561071 59.35 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTAGAGACACAAGCCCCATA Chr15:6561050..6561071 59.35 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022148