Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30983
Trapped Gene
Insr (ENSMUSG00000005534)
Vector Insertion
Chr 8: 3198060 - 3203035
Public Clones IST10555B5 (tigm) IST11599G3 (tigm) IST11552A9 (tigm) IST11657B3 (tigm)
IST10314A10 (tigm) IST14843A4 (tigm) IST10314A10 (tigm) IST14396E9 (tigm)
IST10844D2 (tigm) IST12058G2 (tigm) IST10609D10 (tigm) IST10901F5 (tigm)
IST10453B11 (tigm) IST14464F11 (tigm) IST15095B10 (tigm) IST11054C2 (tigm)
IST10851G5 (tigm) IST14446A3 (tigm) IST12875D3 (tigm) IST10901F5 (tigm)
IST10668H3 (tigm) IST10119D5 (tigm) IST10382C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611267 (Chr8:3202890..3203034 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611267 (Chr8:3202890..3203034 -)
Downstram Exon
ENSMUSE00000638453 (Chr8:3198061..3198275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638456 Chr8:3279029..3279128 No primer for this exon
upstream ENSMUSE00000611295 Chr8:3258383..3258934 No primer for this exon
upstream ENSMUSE00000611294 Chr8:3211379..3211700 No primer for this exon
upstream ENSMUSE00000611293 Chr8:3204630..3204778 No primer for this exon
upstream ENSMUSE00000611267 Chr8:3202890..3203034 No primer for this exon
upstream ENSMUSE00000638453 Chr8:3198061..3198275 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3198060 - 3203035) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611287 Chr8:3194795..3194921 No primer for this exon
downstream ENSMUSE00000611286 Chr8:3192546..3192802 No primer for this exon
downstream ENSMUSE00000611285 Chr8:3189125..3189292 No primer for this exon
downstream ENSMUSE00000611282 Chr8:3184951..3185152 No primer for this exon
downstream ENSMUSE00000233977 Chr8:3174614..3174888 No primer for this exon
downstream ENSMUSE00000233970 Chr8:3173480..3173619 No primer for this exon
downstream ENSMUSE00000611280 Chr8:3169709..3169868 No primer for this exon
downstream ENSMUSE00000611279 Chr8:3167502..3167604 No primer for this exon
downstream ENSMUSE00000611278 Chr8:3165518..3165585 No primer for this exon
downstream ENSMUSE00000611277 Chr8:3163237..3163481 No primer for this exon
downstream ENSMUSE00000611276 Chr8:3161681..3161791 No primer for this exon
downstream ENSMUSE00000611274 Chr8:3161339..3161498 No primer for this exon
downstream ENSMUSE00000611273 Chr8:3159453..3159582 No primer for this exon
downstream ENSMUSE00000611272 Chr8:3158696..3158830 No primer for this exon
downstream ENSMUSE00000569243 Chr8:3155401..3156023 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:3199965..3199985 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGCATTTCCTCCTTTTT Chr8:3200037..3200057 59.78 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005534