Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30984
Trapped Gene
AU018091 (ENSMUSG00000054753)
Vector Insertion
Chr 7: 3162202 - 3164299
Public Clones IST12317B12 (tigm) IST10277C4 (tigm) IST10277C4 (tigm) IST14142H2 (tigm)
IST14846D6 (tigm) IST11629G6 (tigm) IST11186H2 (tigm) IST10454H12 (tigm)
IST11657B3 (tigm) IST14666C8 (tigm) IST14017E6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441056 (Chr7:3163894..3164298 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTTTGGACCTGGTGTCCT Chr7:3164146..3164165 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441056 (Chr7:3163894..3164298 -)
Downstram Exon
ENSMUSE00000441054 (Chr7:3162203..3162361 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTTTGGACCTGGTGTCCT Chr7:3164146..3164165 60 55 GGCTTGGGAGATATGGTTCC Chr7:3162269..3162288 60.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000573725 Chr7:3169016..3169204 ACATTTCCGGTGGCTACTTG Chr7:3169132..3169151 59.99 50
upstream ENSMUSE00000441056 Chr7:3163894..3164298 CACTTTGGACCTGGTGTCCT Chr7:3164146..3164165 60 55
upstream ENSMUSE00000441054 Chr7:3162203..3162361 TATCCAAGTGCCCAGCTTTC Chr7:3162254..3162273 60.21 50

*** Putative Vector Insertion (Chr 7: 3162202 - 3164299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441049 Chr7:3161232..3161409 GAGACGAAACACAGCACCAA Chr7:3161303..3161322 59.88 50
downstream ENSMUSE00000573723 Chr7:3159430..3159542 ACAGTCGAACCCAATGAAGG Chr7:3159421..3159440 59.97 50
downstream ENSMUSE00000441038 Chr7:3159053..3159275 CCCATCCAACGTGGATAAAT Chr7:3159083..3159102 59.51 45
downstream ENSMUSE00000441029 Chr7:3158756..3158895 GCTAGGACCGGAGTGTGTGT Chr7:3158760..3158779 60.18 60
downstream ENSMUSE00000441026 Chr7:3158556..3158658 CTGAGCTCAACGAGGAAAGC Chr7:3158609..3158628 60.28 55
downstream ENSMUSE00000441023 Chr7:3158219..3158430 CTCAGAGTTGGGGTGGTGTT Chr7:3158235..3158254 60 55
downstream ENSMUSE00000441017 Chr7:3157906..3158072 AGAGGAGTGGTGCTCTGAGG Chr7:3157894..3157913 59.58 60
downstream ENSMUSE00000573717 Chr7:3156267..3156375 ATCCAGATTCCAAAGCGAAA Chr7:3156253..3156272 59.65 40
downstream ENSMUSE00000441058 Chr7:3154665..3156109 GCATCCCGTTTCTCCAGTTA Chr7:3155940..3155959 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAGTTTGGATCCCTCCAC Chr7:3164277..3164297 59.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACCTCGTGACTGGGAAA Chr7:3164235..3164255 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054753