Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30986
Trapped Gene
AC138113.3-201 (ENSMUSG00000072608)
Vector Insertion
Chr 14: 43098307 - 43217343
Public Clones IST13271F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000649510 (Chr14:43217159..43217342 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCTAAGGGAGCAGATTG Chr14:43217245..43217264 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000649510 (Chr14:43217159..43217342 -)
Downstram Exon
ENSMUSE00000689356 (Chr14:43098308..43098457 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCTAAGGGAGCAGATTG Chr14:43217245..43217264 60.12 55 CCAGTGCTCATGGTGAACAG Chr14:43098351..43098370 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000649511 Chr14:43218000..43218136 AGGACATCAGTGAGGCCTTG Chr14:43218041..43218060 60.26 55
upstream ENSMUSE00000649510 Chr14:43217159..43217342 GCTGCTAAGGGAGCAGATTG Chr14:43217245..43217264 60.12 55
upstream ENSMUSE00000689356 Chr14:43098308..43098457 TGGGTGTGCAAAGCAAATTA Chr14:43098356..43098375 60.11 40

*** Putative Vector Insertion (Chr 14: 43098307 - 43217343) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689355 Chr14:42948245..42948843 ATGTTCAGCACAGACCCACA Chr14:42948452..42948471 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:43118273..43118293 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTGCATCAGAGACCGTGA Chr14:43124287..43124307 60.14 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072608