Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI30988
Trapped Gene
Clk4 (ENSMUSG00000020385)
Vector Insertion
Chr 11: 51089750 - 51091354
Public Clones IST11058H9 (tigm) IST14548C4 (tigm) IST12748F2 (tigm) IST14827E7 (tigm)
IST14676D6 (tigm) IST13966E7 (tigm) IST11735G6 (tigm) IST10247C12 (tigm)
IST14827G7 (tigm) IST11735F6 (tigm) IST12828G8 (tigm) IST14805C6 (tigm)
IST11709F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000591325 (Chr11:51089620..51089749 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000591325 (Chr11:51089620..51089749 +)
Downstram Exon
ENSMUSE00000591324 (Chr11:51091355..51091437 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386953 Chr11:51076673..51076771 No primer for this exon
upstream ENSMUSE00000679074 Chr11:51076688..51076771 No primer for this exon
upstream ENSMUSE00000716252 Chr11:51080673..51080833 No primer for this exon
upstream ENSMUSE00000720774 Chr11:51080673..51080833 No primer for this exon
upstream ENSMUSE00000579994 Chr11:51081667..51081733 No primer for this exon
upstream ENSMUSE00000579993 Chr11:51082271..51082348 No primer for this exon
upstream ENSMUSE00000579992 Chr11:51084039..51084097 No primer for this exon
upstream ENSMUSE00000653790 Chr11:51085302..51085524 No primer for this exon
upstream ENSMUSE00000679073 Chr11:51085302..51085524 No primer for this exon
upstream ENSMUSE00000679080 Chr11:51085302..51085524 No primer for this exon
upstream ENSMUSE00000653788 Chr11:51086580..51086670 No primer for this exon
upstream ENSMUSE00000679079 Chr11:51086580..51086670 No primer for this exon
upstream ENSMUSE00000679068 Chr11:51086953..51087128 No primer for this exon
upstream ENSMUSE00000591329 Chr11:51087062..51087128 No primer for this exon
upstream ENSMUSE00000716205 Chr11:51087062..51087128 No primer for this exon
upstream ENSMUSE00000716691 Chr11:51087062..51087128 No primer for this exon
upstream ENSMUSE00000721217 Chr11:51087062..51087128 No primer for this exon
upstream ENSMUSE00000104031 Chr11:51088713..51088829 No primer for this exon
upstream ENSMUSE00000591328 Chr11:51088713..51088829 No primer for this exon
upstream ENSMUSE00000104032 Chr11:51088914..51089080 No primer for this exon
upstream ENSMUSE00000591327 Chr11:51088914..51089080 No primer for this exon
upstream ENSMUSE00000579986 Chr11:51089272..51089366 No primer for this exon
upstream ENSMUSE00000591326 Chr11:51089272..51089366 No primer for this exon
upstream ENSMUSE00000579985 Chr11:51089620..51089749 No primer for this exon
upstream ENSMUSE00000591325 Chr11:51089620..51089749 No primer for this exon

*** Putative Vector Insertion (Chr 11: 51089750 - 51091354) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104029 Chr11:51091355..51091437 No primer for this exon
downstream ENSMUSE00000591324 Chr11:51091355..51091437 No primer for this exon
downstream ENSMUSE00000104030 Chr11:51093860..51093939 No primer for this exon
downstream ENSMUSE00000591323 Chr11:51093860..51093939 No primer for this exon
downstream ENSMUSE00000104047 Chr11:51094611..51094701 No primer for this exon
downstream ENSMUSE00000591322 Chr11:51094611..51094701 No primer for this exon
downstream ENSMUSE00000515553 Chr11:51094779..51095265 No primer for this exon
downstream ENSMUSE00000591321 Chr11:51094779..51094906 No primer for this exon
downstream ENSMUSE00000679070 Chr11:51094779..51095268 No primer for this exon
downstream ENSMUSE00000679084 Chr11:51094779..51095266 No primer for this exon
downstream ENSMUSE00000706079 Chr11:51094779..51095265 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCCACAAGGCACTACAGG Chr11:51089712..51089732 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCACAAGGCACTACAGG Chr11:51089712..51089732 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020385