Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31004
Trapped Gene
Cdkn1b (ENSMUSG00000003031)
Vector Insertion
Chr 6: 134871973 - 134872102
Public Clones IST13163F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000196348 (Chr6:134871974..134872101 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000196348 (Chr6:134871974..134872101 +)
Downstram Exon
ENSMUSE00000440619 (Chr6:134871974..134874076 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000315258 Chr6:134870419..134871412 No primer for this exon
upstream ENSMUSE00000440622 Chr6:134870435..134871412 No primer for this exon

*** Putative Vector Insertion (Chr 6: 134871973 - 134872102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000196348 Chr6:134871974..134872101 No primer for this exon
downstream ENSMUSE00000440619 Chr6:134871974..134874076 No primer for this exon
downstream ENSMUSE00000650819 Chr6:134874261..134875531 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCCAACAGAACAGAAGAA Chr6:134871996..134872016 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCCAACAGAACAGAAGAA Chr6:134871996..134872016 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003031