Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31023
Trapped Gene
2610016C23Rik (ENSMUSG00000019992)
Vector Insertion
Chr 10: 20068242 - 20072629
Public Clones IST14435F6 (tigm) IST10034E8 (tigm) IST12236B4 (tigm) IST14935H6 (tigm)
IST13102A1 (tigm) IST12973C2 (tigm) IST10818D5 (tigm) IST12677B2 (tigm)
IST12355H12 (tigm) IST10361C4 (tigm) IST11031D2 (tigm) IST13069D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099607 (Chr10:20068141..20068241 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099607 (Chr10:20068141..20068241 +)
Downstram Exon
ENSMUSE00000099610 (Chr10:20072630..20072734 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644692 Chr10:20067625..20067729 No primer for this exon
upstream ENSMUSE00000099607 Chr10:20068141..20068241 No primer for this exon

*** Putative Vector Insertion (Chr 10: 20068242 - 20072629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099610 Chr10:20072630..20072734 No primer for this exon
downstream ENSMUSE00000099604 Chr10:20073173..20073285 No primer for this exon
downstream ENSMUSE00000099614 Chr10:20073836..20074071 No primer for this exon
downstream ENSMUSE00000577173 Chr10:20077061..20077572 No primer for this exon
downstream ENSMUSE00000666569 Chr10:20078022..20078024 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTGCTGGAATATTTTGGTGT Chr10:20068209..20068230 59.88 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGTCTCGTTATTCGTGA Chr10:20068278..20068298 59.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019992