Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31024
Trapped Gene
Mllt10 (ENSMUSG00000026743)
Vector Insertion
Chr 2: 18031519 - 18043871
Public Clones IST12973C2 (tigm) IST10034E8 (tigm) IST13069D5 (tigm) IST12355H12 (tigm)
IST13102A1 (tigm) IST11031D2 (tigm) IST14705A1 (tigm) IST14935H6 (tigm)
IST13351D4 (tigm) IST13075A8 (tigm) IST10361C4 (tigm) IST12677B2 (tigm)
IST11722H1 (tigm) IST13846B2 (tigm) IST13405B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569864 (Chr2:18031409..18031518 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569864 (Chr2:18031409..18031518 +)
Downstram Exon
ENSMUSE00000162334 (Chr2:18043872..18043975 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40 TGCTTTGCTTTCTCGTCCTT Chr2:18043916..18043935 60.13 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700262 Chr2:17976898..17976998 ATAAGCTCTCCCGACGTTCC Chr2:17976904..17976923 60.6 55
upstream ENSMUSE00000700203 Chr2:17986212..17986491 GCCTGCTTGATTATGTGTGC Chr2:17986309..17986328 59.31 50
upstream ENSMUSE00000700156 Chr2:17986263..17986491 GCCTGCTTGATTATGTGTGC Chr2:17986309..17986328 59.31 50
upstream ENSMUSE00000700200 Chr2:17986314..17986491 CAAGGACATGGCTCCTGACT Chr2:17986434..17986453 60.26 55
upstream ENSMUSE00000720056 Chr2:17986662..17986821 GTGTCACTGGAGGACGAGGT Chr2:17986683..17986702 60.16 60
upstream ENSMUSE00000720069 Chr2:17986662..17986821 GTGTCACTGGAGGACGAGGT Chr2:17986683..17986702 60.16 60
upstream ENSMUSE00000424153 Chr2:17992752..17992831 GGACCGTGGTTTTGTAGGAA Chr2:17992781..17992800 59.83 50
upstream ENSMUSE00000700154 Chr2:17992752..17992831 GGACCGTGGTTTTGTAGGAA Chr2:17992781..17992800 59.83 50
upstream ENSMUSE00000700153 Chr2:18014411..18014461 No primer for this exon
upstream ENSMUSE00000700151 Chr2:18022631..18022633 No primer for this exon
upstream ENSMUSE00000162340 Chr2:18023085..18023139 TGTGTCCCCATAAAGATGGA Chr2:18023095..18023114 58.77 45
upstream ENSMUSE00000569864 Chr2:18031409..18031518 ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40
upstream ENSMUSE00000569874 Chr2:18031409..18031518 ACAATGGAGCCAATCGTTTT Chr2:18031468..18031487 59.43 40

*** Putative Vector Insertion (Chr 2: 18031519 - 18043871) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162334 Chr2:18043872..18043975 TGCTTTGCTTTCTCGTCCTT Chr2:18043916..18043935 60.13 45
downstream ENSMUSE00000569863 Chr2:18043872..18043975 TGCTTTGCTTTCTCGTCCTT Chr2:18043916..18043935 60.13 45
downstream ENSMUSE00000162335 Chr2:18045346..18045439 TCCCTTCTTCTTCACAAAGCA Chr2:18045385..18045405 59.98 42.86
downstream ENSMUSE00000700197 Chr2:18045346..18045439 TCCCTTCTTCTTCACAAAGCA Chr2:18045385..18045405 59.98 42.86
downstream ENSMUSE00000162341 Chr2:18047761..18047856 TTAGATCCCCGTTTGCTCTTT Chr2:18047785..18047805 60.08 42.86
downstream ENSMUSE00000700194 Chr2:18047761..18047856 TTAGATCCCCGTTTGCTCTTT Chr2:18047785..18047805 60.08 42.86
downstream ENSMUSE00000700150 Chr2:18047783..18047856 No primer for this exon
downstream ENSMUSE00000162333 Chr2:18068404..18068499 GACGGTTCTGGTTGCTTCTT Chr2:18068462..18068481 59.33 50
downstream ENSMUSE00000700193 Chr2:18068404..18068499 GACGGTTCTGGTTGCTTCTT Chr2:18068462..18068481 59.33 50
downstream ENSMUSE00000162330 Chr2:18081083..18081338 AAAGGGGCTAGATGCTGACA Chr2:18081334..18081353 59.84 50
downstream ENSMUSE00000700192 Chr2:18081083..18081338 AAAGGGGCTAGATGCTGACA Chr2:18081334..18081353 59.84 50
downstream ENSMUSE00000162332 Chr2:18083944..18084513 ACTGGAGACGAGCCAACACT Chr2:18084508..18084527 59.91 55
downstream ENSMUSE00000700189 Chr2:18083944..18084513 ACTGGAGACGAGCCAACACT Chr2:18084508..18084527 59.91 55
downstream ENSMUSE00000700149 Chr2:18084235..18084513 ACTGGAGACGAGCCAACACT Chr2:18084508..18084527 59.91 55
downstream ENSMUSE00000162337 Chr2:18091881..18091925 TCATGTCGATACTGCATGGAA Chr2:18091907..18091927 60.09 42.86
downstream ENSMUSE00000711455 Chr2:18091881..18091925 TCATGTCGATACTGCATGGAA Chr2:18091907..18091927 60.09 42.86
downstream ENSMUSE00000717167 Chr2:18091881..18091925 TCATGTCGATACTGCATGGAA Chr2:18091907..18091927 60.09 42.86
downstream ENSMUSE00000162325 Chr2:18092670..18092702 No primer for this exon
downstream ENSMUSE00000700187 Chr2:18092670..18092702 No primer for this exon
downstream ENSMUSE00000162336 Chr2:18107845..18108023 GAGAGAGCTCCCACCTGTTG Chr2:18107980..18107999 59.99 60
downstream ENSMUSE00000700185 Chr2:18107845..18108023 GAGAGAGCTCCCACCTGTTG Chr2:18107980..18107999 59.99 60
downstream ENSMUSE00000162327 Chr2:18118210..18118327 CTGGTGCCTGACTGAGAGAA Chr2:18118252..18118271 59.12 55
downstream ENSMUSE00000700184 Chr2:18118210..18118327 CTGGTGCCTGACTGAGAGAA Chr2:18118252..18118271 59.12 55
downstream ENSMUSE00000162329 Chr2:18119552..18119624 CTACGGGCATTGTCTCCAAG Chr2:18119582..18119601 60.65 55
downstream ENSMUSE00000700183 Chr2:18119552..18119624 CTACGGGCATTGTCTCCAAG Chr2:18119582..18119601 60.65 55
downstream ENSMUSE00000162338 Chr2:18125228..18125382 TCCTTCACTCCACTGCCTCT Chr2:18125348..18125367 59.99 55
downstream ENSMUSE00000700180 Chr2:18125228..18125382 TCCTTCACTCCACTGCCTCT Chr2:18125348..18125367 59.99 55
downstream ENSMUSE00000162328 Chr2:18127628..18127816 ACTGGGGTTTGTCGTTATGG Chr2:18127782..18127801 59.71 50
downstream ENSMUSE00000700174 Chr2:18127628..18127816 ACTGGGGTTTGTCGTTATGG Chr2:18127782..18127801 59.71 50
downstream ENSMUSE00000162339 Chr2:18128178..18128266 GCTGTTCAGGGAATCAGGAG Chr2:18128206..18128225 59.8 55
downstream ENSMUSE00000700172 Chr2:18128178..18128266 GCTGTTCAGGGAATCAGGAG Chr2:18128206..18128225 59.8 55
downstream ENSMUSE00000162342 Chr2:18128407..18128771 CCGTTAATTGCCAGTTGGTT Chr2:18128645..18128664 59.86 45
downstream ENSMUSE00000700164 Chr2:18128407..18128771 CCGTTAATTGCCAGTTGGTT Chr2:18128645..18128664 59.86 45
downstream ENSMUSE00000162326 Chr2:18129410..18129506 CTGCTGCTGCTGGATAAACA Chr2:18129473..18129492 60.16 50
downstream ENSMUSE00000700161 Chr2:18129410..18129506 CTGCTGCTGCTGGATAAACA Chr2:18129473..18129492 60.16 50
downstream ENSMUSE00000162323 Chr2:18130377..18130574 AGCACCTGCAAGGAGATTGT Chr2:18130499..18130518 59.87 50
downstream ENSMUSE00000700160 Chr2:18130377..18130574 AGCACCTGCAAGGAGATTGT Chr2:18130499..18130518 59.87 50
downstream ENSMUSE00000647377 Chr2:18132395..18132597 CTGGCCATTTTCAAGTGTCA Chr2:18132459..18132478 59.69 45
downstream ENSMUSE00000700147 Chr2:18132395..18134013 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700152 Chr2:18132395..18134015 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700202 Chr2:18132395..18134016 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55
downstream ENSMUSE00000700205 Chr2:18132395..18134017 GCCCCAGTTGAGGATCTGTA Chr2:18132951..18132970 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAATCGCCTTGCAGCACA Chr2:18043568..18043588 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTATATCGTGACTGGGAAAACC Chr2:18034562..18034586 58.53 41.67 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026743