Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31029
Trapped Gene
Rbm16 (ENSMUSG00000046201)
Vector Insertion
Chr 17: 3191962 - 3193013
Public Clones IST13796D8 (tigm) IST12809D1 (tigm) IST13377E12 (tigm) IST11074G1 (tigm)
IST13459H4 (tigm) IST13034C3 (tigm) IST13749A5 (tigm) IST13034B4 (tigm)
IST10299B4 (tigm) IST10702G11 (tigm) IST13920F4 (tigm) IST14118C8 (tigm)
IST14255D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000280487 (Chr17:3191817..3191961 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTAGTTCCTCCAGCGTTTCC Chr17:3191850..3191869 59.31 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000280487 (Chr17:3191817..3191961 +)
Downstram Exon
ENSMUSE00000445485 (Chr17:3193014..3193082 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTAGTTCCTCCAGCGTTTCC Chr17:3191850..3191869 59.31 50 TGGTACTACCGGTGGGATTG Chr17:3193081..3193100 60.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658492 Chr17:3114967..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60
upstream ENSMUSE00000658491 Chr17:3114979..3115418 GTGGGAGGAAGAGGAAGGAG Chr17:3115070..3115089 60.19 60
upstream ENSMUSE00000367004 Chr17:3145075..3145158 AAAGGCAGCCATCAAAGCTA Chr17:3145134..3145153 59.98 45
upstream ENSMUSE00000468506 Chr17:3148536..3148580 No primer for this exon
upstream ENSMUSE00000547043 Chr17:3150785..3150943 CATGTGGTTGCTGGAATTTG Chr17:3150880..3150899 59.96 45
upstream ENSMUSE00000379333 Chr17:3159163..3159324 GGCATCAGTTTGGTCAAGAAA Chr17:3159224..3159244 60.1 42.86
upstream ENSMUSE00000345755 Chr17:3162959..3163112 CAGTTGTCACGCCTGTTTTG Chr17:3163059..3163078 60.34 50
upstream ENSMUSE00000392504 Chr17:3164147..3164277 TGGTCCAAGGCTTACCTGAT Chr17:3164180..3164199 59.55 50
upstream ENSMUSE00000348840 Chr17:3167963..3168139 ACACTTACGCCCTTGGATCA Chr17:3168101..3168120 60.52 50
upstream ENSMUSE00000333169 Chr17:3169327..3169406 TTTGGGGAAGATTCTGAGCA Chr17:3169348..3169367 60.71 45
upstream ENSMUSE00000445526 Chr17:3171103..3171220 GCAGCAGAACTTGGAGCAGT Chr17:3171163..3171182 60.74 55
upstream ENSMUSE00000367371 Chr17:3177093..3177224 GATAGCCAGGAGGGGACATT Chr17:3177105..3177124 60.29 55
upstream ENSMUSE00000280233 Chr17:3177611..3177723 TGAAGGGCAAGATGTTGTTG Chr17:3177625..3177644 59.69 45
upstream ENSMUSE00000280209 Chr17:3178155..3178348 GAAAGCGAAAGCACAGGAAG Chr17:3178196..3178215 60.13 50
upstream ENSMUSE00000280184 Chr17:3185064..3185164 GCAGCACTACTCTCTGGGTTG Chr17:3185067..3185087 60.07 57.14
upstream ENSMUSE00000235905 Chr17:3185761..3185874 CATTTCGGGCTCTTCAGAAA Chr17:3185813..3185832 60.32 45
upstream ENSMUSE00000280138 Chr17:3187589..3187745 GTGGATCTTGGCGTCACATA Chr17:3187643..3187662 59.53 50
upstream ENSMUSE00000403192 Chr17:3190147..3190280 CAGAGGTTTTCCCTCCTCCT Chr17:3190246..3190265 59.67 55
upstream ENSMUSE00000280487 Chr17:3191817..3191961 TTAGTTCCTCCAGCGTTTCC Chr17:3191850..3191869 59.31 50

*** Putative Vector Insertion (Chr 17: 3191962 - 3193013) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000445485 Chr17:3193014..3193082 TGGTACTACCGGTGGGATTG Chr17:3193081..3193100 60.63 55
downstream ENSMUSE00000280452 Chr17:3195778..3195993 GTCATGGACAATGGTGGTTG Chr17:3195808..3195827 59.66 50
downstream ENSMUSE00000400161 Chr17:3196760..3198855 GTAAGCCTTTTGGACCACCA Chr17:3197746..3197765 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTTCACAACCACCTCCT Chr17:3191942..3191962 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTTCACAACCACCTCCT Chr17:3191942..3191962 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046201