Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31033
Trapped Gene
Mcc (ENSMUSG00000071856)
Vector Insertion
Chr 18: 44884118 - 44919075
Public Clones (sanger) (sanger) (sanger) IST11548D6 (tigm) IST11003F1 (tigm)
IST10461D7 (tigm) IST15073B2 (tigm) IST10176B8 (tigm) IST10923H6 (tigm)
IST12271G3 (tigm) IST11028D2 (tigm) IST11807D12 (tigm) IST12313G10 (tigm)
IST14508B4 (tigm) IST11003F1 (tigm) IST14594C12 (tigm) IST12072F10 (tigm)
IST10843H5 (tigm) IST12927E1 (tigm) IST12788G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000659415 (Chr18:44918830..44919074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACGAGCAGTGACAACAGT Chr18:44918834..44918853 59.94 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000659415 (Chr18:44918830..44919074 -)
Downstram Exon
ENSMUSE00000659414 (Chr18:44884119..44884330 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACGAGCAGTGACAACAGT Chr18:44918834..44918853 59.94 55 CAAAGAGCTTCCGCCATACT Chr18:44884187..44884206 59.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659416 Chr18:44971693..44971836 No primer for this exon
upstream ENSMUSE00000659415 Chr18:44918830..44919074 CCACGAGCAGTGACAACAGT Chr18:44918834..44918853 59.94 55
upstream ENSMUSE00000659414 Chr18:44884119..44884330 GAGCTGGGAGGATGATTCTG Chr18:44884289..44884308 59.76 55

*** Putative Vector Insertion (Chr 18: 44884118 - 44919075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000625458 Chr18:44693841..44693954 TGCTTTGGCCAACTTCTTTT Chr18:44693822..44693841 59.86 40
downstream ENSMUSE00000625457 Chr18:44679171..44679313 GCTCCTCATAGCGGAGTGTC Chr18:44679222..44679241 59.98 60
downstream ENSMUSE00000625456 Chr18:44669751..44669893 GCTGAGCTCTGACCGAAGTT Chr18:44669832..44669851 59.75 55
downstream ENSMUSE00000625455 Chr18:44653036..44653199 CTTAATGGCCAAGTCGCAGT Chr18:44653014..44653033 60.27 50
downstream ENSMUSE00000625454 Chr18:44650778..44650984 CGTCAGGCTTTCGTTCTCTT Chr18:44650846..44650865 59.62 50
downstream ENSMUSE00000625453 Chr18:44635886..44636032 TTAGCGATGGGGATGTCATT Chr18:44635865..44635884 60.3 45
downstream ENSMUSE00000625452 Chr18:44634788..44634877 GGCCTATCAGATGATGACGA Chr18:44634797..44634816 58.62 50
downstream ENSMUSE00000625451 Chr18:44633278..44633426 TGGCAGATCCGTGTGAGTAG Chr18:44633308..44633327 59.85 55
downstream ENSMUSE00000625450 Chr18:44628035..44628175 GTGGCGTTGGATTCGTACTT Chr18:44628040..44628059 60 50
downstream ENSMUSE00000625449 Chr18:44623492..44623595 No primer for this exon
downstream ENSMUSE00000625448 Chr18:44619453..44619636 TTCATCCCCTGACTGGTCTC Chr18:44619595..44619614 60.05 55
downstream ENSMUSE00000625447 Chr18:44608859..44609093 GCCTCTTGGCTTGACATCAT Chr18:44608897..44608916 60.23 50
downstream ENSMUSE00000625446 Chr18:44605384..44605590 CTCCAGGGCTTTCTTCTCCT Chr18:44605506..44605525 59.95 55
downstream ENSMUSE00000625445 Chr18:44602566..44602663 TCGTCCTTAGTTCGGCAAGT Chr18:44602590..44602609 59.88 50
downstream ENSMUSE00000625444 Chr18:44590990..44591112 CTCTGCTGACTGCTGGTGTC Chr18:44590997..44591016 59.76 60
downstream ENSMUSE00000625443 Chr18:44589118..44589721 GCAGGGCTATTCTTTGCTTG Chr18:44589566..44589585 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCTATCCGACCCAGAACC Chr18:44889102..44889122 58.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCTATCCGACCCAGAACC Chr18:44889102..44889122 58.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071856